Jump to content
MycoMap Beta

Stephen Russell

Administrators
  • Content Count

    43,298
  • Joined

  • Last visited

  • Days Won

    42

 Content Type 

Profiles

MycoMap Reports

Bug Database

Audio

Common Names

MycoMap Articles

Scientific Names

MO Observations

Documentation

MM Naming

List Manager

Sourcing

Task Manager

Herbaria

MycoBLAST Search

GenBank Accessions

Synonomous Names

UNITE V7.1

Sequences

iNaturalist Reports

MycoPortal

Dyeables

References

Authors

Journal

Fungal Primers

Gallery

Forums

Events

Downloads

Store

Links Directory

Everything posted by Stephen Russell

  1. Changed MycoMap Location to Mi, Michigan, UNITED STATES Changed Collection Date to 05/24/2018 Changed MycoMap Species Name to Amanita "sp-IN10" Changed Metadata Verified to No Changed Type to No
  2. until
    West Coast Online MycoBlitz 2023: January 13 - 29, 2023 - Project Link Summer Continental MycoBlitz: August 11 - 20, 2023 - Project Link Fall Continental MycoBlitz: October 13 - 22, 2023 - Project Link
  3. Original chimeric sequence: GTCGTAACAAGGTTTCCGTAGGCATTCAAGTCTATCGGGGCGCCAGTAATGGTTCTTCCGTGGAGTACACTTGCCGAAGCCTTAGTGGCCCGAAAGGGTTGATCCAGCGACTCTAAACAAGTAGGCGTCATTAAACGCTAGTCCCCGAGTTCTAGGGGGCGACACTATCAAATTGCGGGGAAATCCTGTCAAGTCTTCACTACCGCGGCTCGTCGAAAGGCAGAGTGCAGCACCGGGTTAATGACCTTGGGGATGGTAAAAACGTGAAGAATAGGGGCAATCCGCAGCCAAGCGCTAAGTCTTTCCGGAGATATGCGTGCAGTTCACAGGCCAAATGGTAGTGGGCGTCTCTCTGAGACGCTTAAGATATGGTCGAGCCCCATTCGAAAGTCTGGGTAAAAGACTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTTGGAGCCTCGCGGCTTCGCCACTTTCCGGCTGTGCGCCCTTTGCGGGGCTTGCACGCCGGGAATCCTTCACACACCTGTGCACCGTTCGTTTGGTGGGACCTCCGGGTTCGCCATTCGCCTTTACACCGAACGTCTGTCTCGAATGTCTAAACTTTTAAATAAGTGCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTTGAGTGTCACGTGAAACCTCATCCGGTCGATGTCAAAGTCGCACTCGGGTGGATTTGGACCGTGCCGTTTGTTCGGCTCGTCCTGAAATGCATTAGCTGGGTCGCCGGACCGTGTTGGCCGTGGTGTGATAATCTATCTGCGCCTATAAGTGCCTTTGGTTCGTGCGGTGCGGCTCATAACCGTCCCTTAAACGAGACAACTCTCTTTTAACGCTTTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTT
  4. Original chimeric sequence: GTCGTAACAAGGTTTCCGTAGGCATTCAAGTCTATCGGGGCGCCAGTAATGGTTCTTCCGTGGAGTACACTTGCCGAAGCCTTAGTGGCCCGAAAGGGTTGATCCAGCGACTCTAAACAAGTAGGCGTCATTAAACGCTAGTCCCCGAGTTCTAGGGGGCGACACTATCAAATTGCGGGGAAATCCTGTCAAGTCTTCACTACCGCGGCTCGTCGAAAGGCAGAGTGCAGCACCGGGTTAATGACCTTGGGGATGGTAAAAACGTGAAGAATAGGGGCAATCCGCAGCCAAGCGCTAAGTCTTTCCGGAGATATGCGTGCAGTTCACAGGCCAAATGGTAGTGGGCGTCTCTCTGAGACGCTTAAGATATGGTCGAGCCCCATTCGAAAGTCTGGGTAAAAGACTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTTGGAGCCTCGCGGCTTCGCCACTTTCCGGCTGTGCGCCCTTTGCGGGGCTTGCACGCCGGGAATCCTTCACACACCTGTGCACCGTTCGTTTGGTGGGACCTCCGGGTTCGCCATTCGCCTTTACACCGAACGTCTGTCTCGAATGTCTAAACTTTTAAATAAGTGCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTTGAGTGTCACGTGAAACCTCATCCGGTCGATGTCAAAGTCGCACTCGGGTGGATTTGGACCGTGCCGTTTGTTCGGCTCGTCCTGAAATGCATTAGCTGGGTCGCCGGACCGTGTTGGCCGTGGTGTGATAATCTATCTGCGCCTATAAGTGCCTTTGGTTCGTGCGGTGCGGCTCATAACCGTCCCTTAAACGAGACAACTCTCTTTTAACGCTTTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTT
  5. Mallocybe sp. 'AZ01' isolate S.D. Russell ONT SJ iNaturalist # 131844666 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  6. Cortinarius subturibulosus isolate S.D. Russell ONT SJ iNaturalist # 131526593 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  7. Mallocybe sp. 'AZ01' isolate S.D. Russell ONT SJ iNaturalist # 131154234 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  8. Cortinarius sp. 'transiens-NY01' isolate S.D. Russell ONT SJ iNaturalist # 128954671 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  9. Russula sp. 'amoenolens-IN01' isolate S.D. Russell ONT SJ iNaturalist # 125828732 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  10. Leucocoprinus longistriatus isolate S.D. Russell ONT SJ iNaturalist # 126274286 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  11. Leucoagaricus sp. 'FL01' isolate S.D. Russell ONT SJ iNaturalist # 125868553 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  12. Echinoderma asperum isolate S.D. Russell ONT SJ iNaturalist # 128915882 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  13. Aleuria sp. 'aurantia-IN01' isolate S.D. Russell ONT SJ iNaturalist # 139059260 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  14. Phaeomarasmius proximans isolate S.D. Russell ONT SJ iNaturalist # 139059345 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
×
×
  • Create New...