Jump to content
MycoMap Beta

Stephen Russell

Administrators
  • Content Count

    43,298
  • Joined

  • Last visited

  • Days Won

    42

Stephen Russell last won the day on December 19 2022

Stephen Russell had the most liked content!

Community Reputation

53 Excellent

7 Followers

About Stephen Russell

  • Rank
    Advanced Member
  • Birthday January 16

Recent Profile Visitors

The recent visitors block is disabled and is not being shown to other users.

  1. Changed MycoMap Location to Mi, Michigan, UNITED STATES Changed Collection Date to 05/24/2018 Changed MycoMap Species Name to Amanita "sp-IN10" Changed Metadata Verified to No Changed Type to No
  2. until
    West Coast Online MycoBlitz 2023: January 13 - 29, 2023 - Project Link Summer Continental MycoBlitz: August 11 - 20, 2023 - Project Link Fall Continental MycoBlitz: October 13 - 22, 2023 - Project Link
  3. Original chimeric sequence: GTCGTAACAAGGTTTCCGTAGGCATTCAAGTCTATCGGGGCGCCAGTAATGGTTCTTCCGTGGAGTACACTTGCCGAAGCCTTAGTGGCCCGAAAGGGTTGATCCAGCGACTCTAAACAAGTAGGCGTCATTAAACGCTAGTCCCCGAGTTCTAGGGGGCGACACTATCAAATTGCGGGGAAATCCTGTCAAGTCTTCACTACCGCGGCTCGTCGAAAGGCAGAGTGCAGCACCGGGTTAATGACCTTGGGGATGGTAAAAACGTGAAGAATAGGGGCAATCCGCAGCCAAGCGCTAAGTCTTTCCGGAGATATGCGTGCAGTTCACAGGCCAAATGGTAGTGGGCGTCTCTCTGAGACGCTTAAGATATGGTCGAGCCCCATTCGAAAGTCTGGGTAAAAGACTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTTGGAGCCTCGCGGCTTCGCCACTTTCCGGCTGTGCGCCCTTTGCGGGGCTTGCACGCCGGGAATCCTTCACACACCTGTGCACCGTTCGTTTGGTGGGACCTCCGGGTTCGCCATTCGCCTTTACACCGAACGTCTGTCTCGAATGTCTAAACTTTTAAATAAGTGCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTTGAGTGTCACGTGAAACCTCATCCGGTCGATGTCAAAGTCGCACTCGGGTGGATTTGGACCGTGCCGTTTGTTCGGCTCGTCCTGAAATGCATTAGCTGGGTCGCCGGACCGTGTTGGCCGTGGTGTGATAATCTATCTGCGCCTATAAGTGCCTTTGGTTCGTGCGGTGCGGCTCATAACCGTCCCTTAAACGAGACAACTCTCTTTTAACGCTTTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTT
  4. Original chimeric sequence: GTCGTAACAAGGTTTCCGTAGGCATTCAAGTCTATCGGGGCGCCAGTAATGGTTCTTCCGTGGAGTACACTTGCCGAAGCCTTAGTGGCCCGAAAGGGTTGATCCAGCGACTCTAAACAAGTAGGCGTCATTAAACGCTAGTCCCCGAGTTCTAGGGGGCGACACTATCAAATTGCGGGGAAATCCTGTCAAGTCTTCACTACCGCGGCTCGTCGAAAGGCAGAGTGCAGCACCGGGTTAATGACCTTGGGGATGGTAAAAACGTGAAGAATAGGGGCAATCCGCAGCCAAGCGCTAAGTCTTTCCGGAGATATGCGTGCAGTTCACAGGCCAAATGGTAGTGGGCGTCTCTCTGAGACGCTTAAGATATGGTCGAGCCCCATTCGAAAGTCTGGGTAAAAGACTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTTGGAGCCTCGCGGCTTCGCCACTTTCCGGCTGTGCGCCCTTTGCGGGGCTTGCACGCCGGGAATCCTTCACACACCTGTGCACCGTTCGTTTGGTGGGACCTCCGGGTTCGCCATTCGCCTTTACACCGAACGTCTGTCTCGAATGTCTAAACTTTTAAATAAGTGCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTTGAGTGTCACGTGAAACCTCATCCGGTCGATGTCAAAGTCGCACTCGGGTGGATTTGGACCGTGCCGTTTGTTCGGCTCGTCCTGAAATGCATTAGCTGGGTCGCCGGACCGTGTTGGCCGTGGTGTGATAATCTATCTGCGCCTATAAGTGCCTTTGGTTCGTGCGGTGCGGCTCATAACCGTCCCTTAAACGAGACAACTCTCTTTTAACGCTTTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTT
×
×
  • Create New...