Jump to content
MycoMap Beta

Stephen Russell

Administrators
  • Content Count

    43,245
  • Joined

  • Last visited

  • Days Won

    41

Stephen Russell last won the day on July 7

Stephen Russell had the most liked content!

Community Reputation

51 Excellent

7 Followers

About Stephen Russell

  • Rank
    Advanced Member
  • Birthday January 16

Recent Profile Visitors

The recent visitors block is disabled and is not being shown to other users.

  1. Original chimeric sequence: GTCGTAACAAGGTTTCCGTAGGCATTCAAGTCTATCGGGGCGCCAGTAATGGTTCTTCCGTGGAGTACACTTGCCGAAGCCTTAGTGGCCCGAAAGGGTTGATCCAGCGACTCTAAACAAGTAGGCGTCATTAAACGCTAGTCCCCGAGTTCTAGGGGGCGACACTATCAAATTGCGGGGAAATCCTGTCAAGTCTTCACTACCGCGGCTCGTCGAAAGGCAGAGTGCAGCACCGGGTTAATGACCTTGGGGATGGTAAAAACGTGAAGAATAGGGGCAATCCGCAGCCAAGCGCTAAGTCTTTCCGGAGATATGCGTGCAGTTCACAGGCCAAATGGTAGTGGGCGTCTCTCTGAGACGCTTAAGATATGGTCGAGCCCCATTCGAAAGTCTGGGTAAAAGACTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTTGGAGCCTCGCGGCTTCGCCACTTTCCGGCTGTGCGCCCTTTGCGGGGCTTGCACGCCGGGAATCCTTCACACACCTGTGCACCGTTCGTTTGGTGGGACCTCCGGGTTCGCCATTCGCCTTTACACCGAACGTCTGTCTCGAATGTCTAAACTTTTAAATAAGTGCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTTGAGTGTCACGTGAAACCTCATCCGGTCGATGTCAAAGTCGCACTCGGGTGGATTTGGACCGTGCCGTTTGTTCGGCTCGTCCTGAAATGCATTAGCTGGGTCGCCGGACCGTGTTGGCCGTGGTGTGATAATCTATCTGCGCCTATAAGTGCCTTTGGTTCGTGCGGTGCGGCTCATAACCGTCCCTTAAACGAGACAACTCTCTTTTAACGCTTTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTT
  2. Original chimeric sequence: GTCGTAACAAGGTTTCCGTAGGCATTCAAGTCTATCGGGGCGCCAGTAATGGTTCTTCCGTGGAGTACACTTGCCGAAGCCTTAGTGGCCCGAAAGGGTTGATCCAGCGACTCTAAACAAGTAGGCGTCATTAAACGCTAGTCCCCGAGTTCTAGGGGGCGACACTATCAAATTGCGGGGAAATCCTGTCAAGTCTTCACTACCGCGGCTCGTCGAAAGGCAGAGTGCAGCACCGGGTTAATGACCTTGGGGATGGTAAAAACGTGAAGAATAGGGGCAATCCGCAGCCAAGCGCTAAGTCTTTCCGGAGATATGCGTGCAGTTCACAGGCCAAATGGTAGTGGGCGTCTCTCTGAGACGCTTAAGATATGGTCGAGCCCCATTCGAAAGTCTGGGTAAAAGACTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTTGGAGCCTCGCGGCTTCGCCACTTTCCGGCTGTGCGCCCTTTGCGGGGCTTGCACGCCGGGAATCCTTCACACACCTGTGCACCGTTCGTTTGGTGGGACCTCCGGGTTCGCCATTCGCCTTTACACCGAACGTCTGTCTCGAATGTCTAAACTTTTAAATAAGTGCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTTGAGTGTCACGTGAAACCTCATCCGGTCGATGTCAAAGTCGCACTCGGGTGGATTTGGACCGTGCCGTTTGTTCGGCTCGTCCTGAAATGCATTAGCTGGGTCGCCGGACCGTGTTGGCCGTGGTGTGATAATCTATCTGCGCCTATAAGTGCCTTTGGTTCGTGCGGTGCGGCTCATAACCGTCCCTTAAACGAGACAACTCTCTTTTAACGCTTTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTT
  3. Mallocybe sp. 'AZ01' isolate S.D. Russell ONT SJ iNaturalist # 131844666 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  4. Cortinarius subturibulosus isolate S.D. Russell ONT SJ iNaturalist # 131526593 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  5. Mallocybe sp. 'AZ01' isolate S.D. Russell ONT SJ iNaturalist # 131154234 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  6. Cortinarius sp. 'transiens-NY01' isolate S.D. Russell ONT SJ iNaturalist # 128954671 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  7. Russula sp. 'amoenolens-IN01' isolate S.D. Russell ONT SJ iNaturalist # 125828732 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  8. Leucocoprinus longistriatus isolate S.D. Russell ONT SJ iNaturalist # 126274286 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  9. Leucoagaricus sp. 'FL01' isolate S.D. Russell ONT SJ iNaturalist # 125868553 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  10. Echinoderma asperum isolate S.D. Russell ONT SJ iNaturalist # 128915882 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  11. Aleuria sp. 'aurantia-IN01' isolate S.D. Russell ONT SJ iNaturalist # 139059260 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  12. Phaeomarasmius proximans isolate S.D. Russell ONT SJ iNaturalist # 139059345 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  13. Lyophyllum sp. 'decastes-CHINA01' isolate S.D. Russell ONT SJ iNaturalist # 139056314 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  14. Pleurotus sapidus isolate S.D. Russell ONT SJ iNaturalist # 139056250 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
  15. Gymnopilus luteofolius isolate S.D. Russell ONT SJ iNaturalist # 138934904 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
×
×
  • Create New...