Jump to content
MycoMap Beta
S No GenBank link to the sequence
Sequences
  1. S
    OSF2021.121-iNat86541373     ITS
    iNaturalist: iNaturalist #86541373
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence

    ACCTGCGGAAGGATCATTATCGAACGAACAAGAAAAGAAGTCTTGGGAGAGGTCGAGAGGGGGAGAGGGATTGTCGCTGGCCAGATGGGGGTGATTTCCGCTGGCATGTGCACGTCCCTTTTTTCTTTTCGCTTGTTCCATCTCTTTTTCTCTACACACCTGTGCACTCATTGTAGGTCCTCGAGAGAGGATCTATGTTTTCGATCAACCATCATTGAACGTATGTTTGTAGAAGGTCATGAATTTATATATATACAACTTTCAGCAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTCTCAACCATGTCTTGATTGATTTTCGAGCCATGGCTTGGATGGGTGGGGGTTTGCTGGCCTTTTCTCTAGGTCAGCTCTCCTGAAATGCATTAGTGATCTGGCGAGCATGGTCT

  2. S
    OSF2021.121-iNat86541373     ITS
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence

    TATGTTATGTTTCGTGTGGGAGTCATGCATGTGCTGCGAGGCGCGTGCGTTGTACGCTACATGATTCTCTAGTATGAAAGAT

×
×
  • Create New...