Jump to content
MycoMap Beta
Sequences
  1. S
    OSF2021.793-iNat91515778     ITS
    iNaturalist: iNaturalist #91515778
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence

    GTGAACCTGCGGAAGGATCATTACYGAACGCTTGAGGATGTTGCTGGCCTTGAGTGGGCAYGTGCACTCCTTGAACATTCCAACCTCACACCTGTGCACCTTTTGTAGGCTTGCAATGTCGGGCCTATGTATTTTTACCTCACGCACACCGTTTGAATGTCATTTGAATGTCTTGTTATCGATGATAAATGATATACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATTGAATCTTTGAACGCACCTTGCGCCCCTCGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTGAATTCTCAACTTGACCTGGGGGGCTCTCCCTGGACGAGTCAAAGTTGGATTGTGGAGTYGTGCCGGTCACCTTTGGGCGACCGGCTCCTCTGAAAAGCATTAGCGAAAGGTCTCGAGCTAACCCTGGCATTGATAGTGTCATCTATGCCTYTGGTGAAGCCGATCGTACTTTGTTCGCTTCCAGCGGTCCCTCTTGGGACAAATCGAACGCACCTTT

  2. S
    OM972545 Hygrocybe mucronella
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    gtgaacctgcggaaggatcattacygaacgcttgaggatgttgctggccttgagtgggcaygtgcactccttgaacattccaacctcacacctgtgcaccttttgtaggcttgcaatgtcgggcctatgtatttttacctcacgcacaccgtttgaatgtcatttgaatgtcttgttatcgatgataaatgatatacaactttcaacaatggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgatacgtaatgtgaattgcagaattccgtgaatcattgaatctttgaacgcaccttgcgcccctcggtattccgaggggcatgcctgtttgagtgtcattgaattctcaacttgacctggggggctctccctggacgagtcaaagttggattgtggagtygtgccggtcacctttgggcgaccggctcctctgaaaagcattagcgaaaggtctcgagctaaccctggcattgatagtgtcatctatgcctytggtgaagccgatcgtactttgttcgcttccagcggtccctcttgggacaaatcgaacgcaccttt

×
×
  • Create New...