Jump to content
MycoMap Beta
Sequences
  1. S
    DM8-iNat10999117     ITS
    iNaturalist: iNaturalist #10999117
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence

    CTGCGGAAGGATCATTATTGAATTCAAAGTGAAGTTGATGCTGGCTTTCCGAAGCATGTGCACGCTTTGCATATATTCAACCACCTGTGAACCTTTTGTAGATCTAGCACGTTTTCTCAAGGCAACTTGGATGGAGAGCTTGCGGGTTTCTTTACAGAGATCAGCTTCTCTTGAGTGCTCGGATCTATGCTTTACAAACCCTTTAAAATGTAACTGAATGTCATTTAATGGTCTTTATGGCCTTAAACTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACTAGCTTTGCTAGCAAAGGCTTGGATGTGGAGACTGCGGGCTTCTCTAGAAGTCGGCTTCTCTTAAATGCATTAGCGGAACTTTGTGCATCGCTCTTKGTGTGATAATTATCTGCGCCTTGAGTTTGATCACTAATTGTGGTTCAGCTTCTAACCGTCCGCAAGGACAGCTCTTATGACATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

  2. S
    OM212895 Tricholomataceae sp.
    Species name for MycoMap sequence record needs to be updated.
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    ctgcggaaggatcattattgaattcaaagtgaagttgatgctggctttccgaagcatgtgcacgctttgcatatattcaaccacctgtgaaccttttgtagatctagcacgttttctcaaggcaacttggatggagagcttgcgggtttctttacagagatcagcttctcttgagtgctcggatctatgctttacaaaccctttaaaatgtaactgaatgtcatttaatggtctttatggccttaaactaatacaactttcaacaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcaccctttggtattccgaagggtatgcctgtttgagtgtcattaaattctcaaccttactagctttgctagcaaaggcttggatgtggagactgcgggcttctctagaagtcggcttctcttaaatgcattagcggaactttgtgcatcgctcttkgtgtgataattatctgcgccttgagtttgatcactaattgtggttcagcttctaaccgtccgcaaggacagctcttatgacatttgacctcaaatcaggtaggactacccgctgaacttaagcatatcaataagcggagga

Blast Searches
Run Blast Search
×
×
  • Create New...