Jump to content
MycoMap Beta
S No GenBank link to the sequence
Sequences
  1. S
    SJ28-MF31152-iNat12899227     ITS
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence

    TGAACCTGCGGAAGGATCATTAAACGTTAATAATGTGTACTCCCACGAGTATATCATCGTTATAAACCCACCCGTGTATCTCACCTGTTGCTTCCGTGAGCCCGGCGGAGCGACCTCGGTCGCCCCAGTCCCCCACGGGAGGTCTACATCAAACCCTTGCATTTCCATGTCATCTGTCTGATCTTGTTTACAACAAATGTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTCCTGGTATTCCGGGAGGCATGCCTGTTCGAGCGTCATTAAAAACCACTCAAGTTCACTTTTTCTTTTTTGTGTGCTTGGTATTGGAAGAAGAGTTCACCACCCCCCCGTGTCCTCCCTTCCGAAATCCAATGGCGGATCGGCCCCTGTCGCCCCGGCGTAGTAAGTCTTCTTTCGCCTCGGTGACCGAGTCCATCCCGCCCCAAACCCCCCCCTTTCTTTACAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATAT

Blast Searches
Run Blast Search
AG2B6RPF014
A9PZB59X015
×
×
  • Create New...