Jump to content
MycoMap Beta
Sequences
  1. S
    OM212883 Russula cerolens
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    gaggaagtaaaagtcgtaacaaggtttccgtaggtgaacctgcggaaggatcattatcgtacaatggaggtgctggggttgtcgctgacctttgaaagggtcgtgcacgcctcggtgctttcacacataatccatctcaccccttttgtgcatcaccgcgtgggggtcccttttagctagttctgaagggggctttcatgtttttacaaacacacccttttaatgcaatatgtagaatgtcttactttttgcgatsacacgcaatcaatacaactttcaacaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgatacgtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgccctttggcattccgaagggcacacccgtttgagtgtcgtgacatcctcaaaccttcttggtttcttgactgagaaggctttggactttggaggcttttgctggaccttcccttgttgaagccagctcctcttaaatgaattagtggggtctgctttgcttatccttgacgtgataagatgcttctacgtcttgggttttgcactgtttgctctagatcctgcttctaaccgtctcatagaagacaaatggtcgactttgacccacaaaccttgacctcaaatcgggtgagactacccgctgaacttaagcatatc

  2. S
    DM58-iNat17967737     ITS
    iNaturalist: iNaturalist #17967737
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence

    GAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAATGGAGGTGCTGGGGTTGTCGCTGACCTTTGAAAGGGTCGTGCACGCCTCGGTGCTTTCACACATAATCCATCTCACCCCTTTTGTGCATCACCGCGTGGGGGTCCCTTTTAGCTAGTTCTGAAGGGGGCTTTCATGTTTTTACAAACACACCCTTTTAATGCAATATGTAGAATGTCTTACTTTTTGCGATSACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGCATTCCGAAGGGCACACCCGTTTGAGTGTCGTGACATCCTCAAACCTTCTTGGTTTCTTGACTGAGAAGGCTTTGGACTTTGGAGGCTTTTGCTGGACCTTCCCTTGTTGAAGCCAGCTCCTCTTAAATGAATTAGTGGGGTCTGCTTTGCTTATCCTTGACGTGATAAGATGCTTCTACGTCTTGGGTTTTGCACTGTTTGCTCTAGATCCTGCTTCTAACCGTCTCATAGAAGACAAATGGTCGACTTTGACCCACAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAGCATATC

Blast Searches
Run Blast Search
×
×
  • Create New...