Jump to content
MycoMap Beta
S No GenBank link to the sequence
Sequences
  1. S
    MOMS8-MF72585-iNat17734067
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    TAGGTGACCTGCGGAAGGATCATTATTGAATGAACTTGGTGTGGTTGTTGCTGGCCTTCTTTGGGGGCATGTGCACACCCACCATCCTCATCTCTCCACCTGTGCACATCTTGTAGATTTGGATTGACTTTCCGAGGCAACTCGGTCGGGAGGACTGCTGGCGCTAGCTAGCTTTCCTTGCATTTCCAAGTCTATGTTTTTCATATACCCCATTGTATGTAACAGAATGTAACACTAGGCCTTTGTGCCTATAAAACTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTTATCAGCTTTT

  2. S
    MOMS8-MF72585-iNat17734067
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    TTTTGTTGATGATGGCTTGGATATGGGGGTTTATTTTGCTGGCTTCTTCACAGATGGTCAGCTCCCCTTAAATGCATTAGCCGGTGCCCCGCGTGGACTGTCTATTGGTGTGATAATTATCTACGCCGTGGACATCTGCAATTATATGGGTTTGCGCTGCTTCCAATCGTCTGTTAAGTCAGACAATACATGACAATTGACCTCAAATCAGG

Blast Searches
Run Blast Search
10B9V6F7015
10B93ZBS014
×