Jump to content
MycoMap Beta
S No GenBank link to the sequence
Sequences
  1. S
    SJ11-MF31153-iNat15744802     ITS
    iNaturalist: iNaturalist #15744802
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence

    TGAACCTGCGGAAGGATCATTAACTGAAATTTTGGGAAGGGGGGATTAGCTGCTGGCTCTTTTGTGAGGGCATCTGTGCACACCCCTTTCCCTYAATCTCTCCTCTACACCTGTGCAACCTCCTGTGGGCTTGGGGAAACCTGGGCCTGCATCTTGCTTCACACAACTGTAACTTATTTACCAGTGAATGTTTGTTGGCTTT

Blast Searches
Run Blast Search
A9PT8KA401R
×
×
  • Create New...