Jump to content
MycoMap Beta
Sequences
  1. S
    MT241886 Amanita sp.
    Species name for MycoMap sequence record needs to be updated.
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    ctgcggaaggancattattgaataaagtctggtggaggctgttgctggtccaaaaaggcagggcatgtgcacgtctcaacaaaagccagttttgatatacattttcctgtgcatttttgtagacacttttggaatgagaaacttttataggtttcttgctgtgaaacatcaagtgtgtctatggttttcaatgaacacaagtgggatgtataagaaagggaattgttaatgaacaaagttgaatacaactttcaacaatggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcatcttgcgctccttggtattctgaggagcatacctgtttgagtgtcattaaattctcaaaagtcccctctgtgtgagaggaggagttttggacattgggggttgcaggttttataaagccagctctccttgaatgaattagcagggaaatatggcatttttctcgattggtgtgataaagtgtttacaccatgaaataagtgacatatataatctctgctttctaaaggaaatttgtgtcgttgaggcagaaattgactgagttgacctcaaatcaggtaggactacccgctgaactt

  2. S
    SJ19-iNat15708278     ITS
    iNaturalist: iNaturalist #15708278
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence

    GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAAGTCTGGTGGAGGCTGTTGCTGGTCCAAAAAGGCAGGGCATGTGCACGTCTCAACAAAAGCCAGTTTTGATATACATTTTCCTGTGCATTTTTGTAGACACTTTTGGAATGAGAAACTTTTATAGGTTTCTTGCTGTGAAACATCAAGTGTGTCTATGGTTTTCAATGAACACAAGTGGGATGTATAAGAAAGGGAATTGTTAATGAACAAAGTTGAATACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCTGAGGAGCATACCTGTTTGAGTGTCATTAAATTCTCAAAAGTCCCCTCTGTGTGAGAGGAGGAGTTTTGGACATTGGGGGTTGCAGGTTTTATAAAGCCAGCTCTCCTTGAATGAATTAGCAGGGAAATATGGCATTTTTCTCGATTGGTGTGATAAAGTGTTTACACCATGAAATAAGTGACATATATAATCTCTGCTTTCTAAAGGAAATTTGTGTCGTTGAGGCAGAAATTGACTGAGTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCA

Blast Searches
Run Blast Search
UAJ4C5X7014
×
×
  • Create New...