We recently performed a significant upgrade on the underlying site framework. A few items have limited functionality. Full functionality will be restored over the next few days.

Jump to content
MycoMap Beta
S No GenBank link to the sequence
Sequences
  1. S
    MO322771
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAAATGAACCTCGAGGCTGTTGCTGGCCCATCTGGGCATGTGCACGTCTCTGGTCATTACCAATTCCACCTGTGCACACTTGTAGACACTTGGGAATGAGAGACTTTGACCGGTCTCTTGAGGGAATTGAACTCTGGGTGTCTATGCCATTTTATCAAACACTAGTTGCATGTTTATAGAATGACGATTTGATTGAATATAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAACATCTCAAGACCTGTCTGCTTTTGATAGGTATTGGATTTTGGGAGTTGCAGGCTGTTTCAGATATAGCTTGCTCTCCTTGAATGTATTAGTGGAGAAAAGCTGTTGAACTCCATTGGTGTGATAAAATCTATCAATGCCAGGAGCAACGTCGAGTTGTCTCTGCTGTCTAACCCTAACTGTCTGACCCACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATAAAACCGGAAGGA

  2. S
    8776-MF58776-MO322771     ITS
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAAATGAACCTCGAGGCTGTTGCTGGCCCATCTGGGCATGTGCACGTCTCTGGTCATTACCAATTCCACCTGTGCACACTTGTAGACACTTGGGAATGAGAGACTTTGACCGGTCTCTTGAGGGAATTGAACTCTGGGTGTCTATGCCATTTTATCAAACACTAGTTGCATGTTTATAGAATGACGATTTGATTGAATATAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAACATCTCAAGACCTGTCTGCTTTTGATAGGTATTGGATTTTGGGAGTTGCAGGCTGTTTCAGATATAGCTTGCTCTCCTTGAATGTATTAGTGGAGAAAAGCTGTTGAACTCCATTGGTGTGATAAAATCTATCAATGCCAGGAGCAACGTCGAGTTGTCTCTGCTGTCTAACCCTAACTGTCTGACCCACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATAAAACCGGAAGGA

×
×
  • Create New...