Jump to content
MycoMap Beta
S No GenBank link to the sequence
Sequences
  1. S
    8763-MF58763-MO321879
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low Quality Sequence

    TGAACCTGCGGAAGGATCATTATTGAATGAAACTTCTGGCTAGATGCTGTTTTGCTGGCCCTTTGGGGTAATGTGCACGYCTCTGGTCATTTGTTTCTTTTTTGTTCCACCTGTGCACTGCCTGTAGGCATACACTGTGTCTATGATTATGTTTTATATGCACCTTTTATATATGCATGTTCTTTTGGATTGTATAAAATGCAAATGTTTTTACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACACAGCGAAATGTGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCTGAGGAGCATGCCTGTTTGAGTGTCAACTAAACTATCAAAACACAACTCTTGATTGGTGATGTGTTTTTGGACTTTGGGACTATGCTGGGTGTGTCCAGCTGTCCTCAAAAGCATTCATTAGCTTTGGATATGCAACAGTGTGATAAGTTGTCTATGCTGGTATTGCATATCTCTCTGCTTCTAGAAAAAAATTTACGATTCTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCTAATCAATAA

×