Jump to content
MycoMap Beta
S No GenBank link to the sequence
Sequences
  1. S
    LS26-MF18301-MO316463     ITS
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    GTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGCTTGGCTGGCTGTCCCCGTCCATGTGAGGTGTCTTAGACGAGTCGAGTTGTTTGGGAATACAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGTGGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAATAGAGTTAAAAAGTACGAGAAATTGTTGAAAGGGAAGCGCTTGAGACCAGACTTCGGTGGGGAGTGATCAGCCGTCCTTNTGGGCGGTGCACTTGCCCCC

  2. S
    LS26-MF18301-MO316463     ITS
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    CACATTGGCGGGTTCCGTACCCNNTNGNTGGTCCAGGGCGGGCCAGCTGCGACGGTCTCATCCGCAGTCCCTGCGTTTTGGCAGCAAGCCCCGAATCGGGGTGGGAGCGGATCGTGCAATCAATGCTCTGCAGCCACCCATACGGGTTGGGTGAGCGCGCAGAGTAGACTATTGCTGCGCTAAAGGAGACCCGTCGCGGCAGGTGGCGGACGGCACATGCAGGACTGATCCCAACCATGTGTTGATTCCCCTGGGGCCGGGGTTGTAGAATACCCCGGCGACTCGCAGACGGCGTGTACCCTCGTCTGGCCCCCTCTCGCCATTGTCCCAACCAAAACCCTCTGNNTACCCCTTCCCTGTTGCTTCCCCCGGGGCACTGGCTCCGGCCAGCCGGGGGGAGAAACCAAGCAAAAACCCTTTTTCGCAAAAACAGACGTCTGAACATCAAAAACAAAAAAGTTAAAACTTTCAACAACGGATCTCTTGNTTCCCACATCTATGATAGANCGCANCGAAATGCGATAANTAATGTGAATTGCAAATTTCNNNGNNTCATCGAAATCTTTTGAACGCCATTTGCGCTCTCTGGTATTCCGGAGGG

Blast Searches
Run Blast Search
93BBD4A1013
71M6WVJ5013
3ZXG8V45015
×
×
  • Create New...