Jump to content
MycoMap Beta
S No GenBank link to the sequence
Sequences
  1. S
    SJ20-iNat11397076     ITS
    iNaturalist: iNaturalist #11397076
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence

    TGGCCGCGCGGCCGGGTTGATCCTTCCGCGTGACACTTGCCGAAGCCTTAGCAGCCCGAAAGGGTGCATCCCGACGACTATAAACCAGTAGGAGGATGATCAAATGCTAGTCTGCCCTCTCCGGCAGGCGACACTATCAAATTGCGGGAACACCCTAAAGACCTCAACACCAAGCGATCGCGGGAAACCGCGTCGTGGCCGAGCTAATAGCCCTGGGTATGGTAACAGCTTGAGGTATGACGCTCCTGGGAGCCGAAATGGGCAATCCGCAGCCAAGTCCTAAAGCGCTGGAAGGCGCCATGGATGCTGTTCACAGGCCAAATGGTAGTGGGTGATCCCGCACGGGATTGCTTAAGATATGGTCGGGCCCCTTCAGAAATGTTGGGGGTAAGCTCACGTCTGCGCACACTGCTTTGCGCTTTCTTATCGTAACCGTTCCGTAGGTGAACCTGCGGAAGGATCATTGAACTGGATGTGCCCTGCACGCCGGCGCTCCGCGCGGCGAGGAATGCGGGTACACCGGGGGCCCGCGCCTCTGATAAATCGCGGTCGGGGGGCCCCTCGGGAGGCCCTGTCTGTACCCTATGTCGTTGTAGCACCTCGCGTTTCCTCGGCGGGCTCGCCCGCCAACGGGGACCCAAGCAAAACCCATTGACGTACCTGCAGTAACCGTCTCACAAACAATTAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCTTAGGGCATGCCTGTTCGAGCGTCATCTGACCCCTCAAGCACTGCTTGGTGTTGGGCGCCTGTCCCGCCTCCGCGCGCGGACTCGCCTCGAAGACATTGGCGGCCTGTGTATTGGCTATGAGCGCAGCAGATCCGCGCCTCAGACCCTCTCGCGCGGGTGTCCAGGAAGCGACCCCCCATATTTGACCTCGGAT

Blast Searches
Run Blast Search
UAJRN4J3015
×
×
  • Create New...