M Verification data mismatch
Location
Newton County, Newton, Texas, 75966, United States
Collection Date
Original Metadata
Location
USA: Texas, Newton, Newton County
Sequence
TCAGATGTGGATTGCTGGTCCTTCGGGGCATGTGCATTCCYCTGGTCATTTGTTTCTTTTGTTCCACCTGTGAACYGTTGTAGATACTTTANYGTGTCTATGATTTTACATATATTACATGCACACATAATTGATATTGGTTAACATGTATAACAAAAATGATAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACACAGCGAAATG:TGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAATGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTG:AGTGTCATAAAACTATCAAAGCATTTTTTTGTAATGTGCTTTGGATTGTGGGAGTGCNGGAGTGTGCGCCTCNGGCTCTCCTGAAAAGTATTASCTATGAGGCAATCGGTGTGATAATTAGTCTACACCTCTTTATGTCTCGGCTTGTTTGTATGA
Identified By
K. Griffith
MyCoPortal Location
U.S.A., Texas, Newton, Canyon Rim Nature Trail; Mayflower, SH87