Jump to content
MycoMap Beta
Sequences
  1. S
    BB122-AVIS19-MO118117     ITS
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    AGAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAATACTTGATGGGTTGTAGCTGGCCTCTTGGGGCATGTGCACGCCTGTCATTRTTCTATTCATCCATCTGTGCACCATTTGTAGTCTTTGAGGGCTGAGAGCAGCTGAGTATCAGTCGAGAGACTGGATGAGAGGCTTGCATGTGCATGAGTGTACAGCTTTCCTCAGCGACCAGGCTATGATCTCCCTCAGAGTTCTATGTCTTTATCTTATAAACCACATAGTATGTTGCAGAATGTATTTAACAAGGGCCTTGTTGTGCCCATATAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCAGTTAATTCTCAATCCCCTCTGGCTTTTGTAGCTAGTCTTGTGGGACTTGGATGTGGAGGCTTTGCGGGCCCTTTTGATGGGTCGGCTCCTCTGAAATGCATTAGCGGAACTGTTTGCAATCCGTCACAGGTGTGATAAATATCTACACCAATGGGGGTTGCTCTCTAATTGTTCAGCTTCTAACAGGTCCCTTTAATAGGACAGATTTTTGAACTTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA

  2. S
    MW567925 Leucoagaricus sp. 'IN-11'
    Species name for MycoMap sequence record needs to be updated.
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    agagtaaaagtcgtaacaaggtttccgtaggtgaacctgcggaaggatcattattgaataatacttgatgggttgtagctggcctcttggggcatgtgcacgcctgtcattrttctattcatccatctgtgcaccatttgtagtctttgagggctgagagcagctgagtatcagtcgagagactggatgagaggcttgcatgtgcatgagtgtacagctttcctcagcgaccaggctatgatctccctcagagttctatgtctttatcttataaaccacatagtatgttgcagaatgtatttaacaagggccttgttgtgcccatataaatctatacaactttcagcaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcgctccttggtattccgaggagcatgcctgtttgagtgtcagttaattctcaatcccctctggcttttgtagctagtcttgtgggacttggatgtggaggctttgcgggcccttttgatgggtcggctcctctgaaatgcattagcggaactgtttgcaatccgtcacaggtgtgataaatatctacaccaatgggggttgctctctaattgttcagcttctaacaggtccctttaataggacagatttttgaacttttgacctcaaatcaggtaggactacccgctgaacttaa

  3. S
    MO118117
    Species name for MycoMap sequence record needs to be updated.
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    AGAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAATACTTGATGGGTTGTAGCTGGCCTCTTGGGGCATGTGCACGCCTGTCATTRTTCTATTCATCCATCTGTGCACCATTTGTAGTCTTTGAGGGCTGAGAGCAGCTGAGTATCAGTCGAGAGACTGGATGAGAGGCTTGCATGTGCATGAGTGTACAGCTTTCCTCAGCGACCAGGCTATGATCTCCCTCAGAGTTCTATGTCTTTATCTTATAAACCACATAGTATGTTGCAGAATGTATTTAACAAGGGCCTTGTTGTGCCCATATAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCAGTTAATTCTCAATCCCCTCTGGCTTTTGTAGCTAGTCTTGTGGGACTTGGATGTGGAGGCTTTGCGGGCCCTTTTGATGGGTCGGCTCCTCTGAAATGCATTAGCGGAACTGTTTGCAATCCGTCACAGGTGTGATAAATATCTACACCAATGGGGGTTGCTCTCTAATTGTTCAGCTTCTAACAGGTCCCTTTAATAGGACAGATTTTTGAACTTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA

Blast Searches
Run Blast Search
G5FJH23S01R
4TXC2TNZ014
FM52F8F2014
×
×
  • Create New...