Jump to content
MycoMap Beta
S No GenBank link to the sequence
Sequences
  1. S
    LEP95 - MO 109593 - Leucoagaricus sp. - ITS - Indiana     ITS
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    TAGGTGACCTGCGGAAGGATCATTATTGAATACATTGCCTCGATGGGTTGTTGCTGGCCTTTTGGGGCATGTGCACACCTGTCTTGACTCTATTCATCCACCTGTGCACCTCTTGTAGTCCTTTGTTTTCTGATATATATGATATCCATTCAGCTGAGATACTGCTGGATTTGAGGTTTGCCTTGTCTTCACAACCTGGCTTTCCTTTTTGTCATGGATCTTATTGACTCAGAGAGCACAAAAAGGGCTATGTCTTTTTTATCATAAACCATGTAGTCTGTCATCAGAATGTCATCAATGGGCCTTTCAGTGCCTATAAAACTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCAGTAAATTCTCAACCCCTCTGGCTTTTTGCTGGTTGGGGCTTGGATGCTGGAGGCTATTGCTGGTCTGAGTTTCTCAAGGTCAGCTCCTCTGAAATGCATTAGCAGAACCCTTTGCAATCTGCTACAGGTGTGATAATTATCTACATCTAAGGTTGCTCAGTGTCTTGTTCAGCTGCCAACAGTCCAAAAGGACAACATTCATTTACTGAACCTT

Blast Searches
Run Blast Search
1773T5R0013
4TWSZ11C014
03YTVHCE014
×
×
  • Create New...