Jump to content
MycoMap Beta
Sequences
  1. S
    LEP105 - MO 109358 - Lepiota caerulescens - ITS - Indiana     ITS
    Mushroom Observer: MO109358
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    TAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATGTACTTGATGGGTTGTTGCTGGCTCTTCTAAGCATGTGCACGCCTGTCTTGACTCCATTCGTCCACCTGTGCACCTTTTGTAGTCCATTTGTTGGAGGCAGTGGTTTTCAGTTGAAAGGCTTGATTTTGAGGTTTGCTCAATGCAAAATGTGGGCTCTCTTCTTGGCCATGAAACCTCCTTCAAGTGGAACTATGTCTTTTAATCATAAACTTGTAGTATGTTGTCAGAATGTGTTAAATGGCCTCTGTGCCTGTAAAACCTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCCTTGGTATTCCGAGGAGTATGCCTGTTTGAGTGTCAGTTAAATCTCATTTCCCTCCGGTTTTTGTTTCAAGGACTGGTTTGGGGACTTGGATGTGGAGGTTTTGTTGGCTTTTTGCTAGGTCAGCTCCTCTGAAATGTATTAGTGGAACTGTTTGCAATCCATCACAGGTGTGATAATTCTTGACGCCATTGGGTTGCTCTCTGCTTGTTCTGCTTCCAACTGTCTCACTATATGTGGACAACCATTACTGAACATTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTT

  2. S
    MW567920 Leucoagaricus sp. 'caerulescens-IN03'
    Species name for MycoMap sequence record needs to be updated.
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    taaaagtcgtaacaaggtttccgtaggtgaacctgcggaaggatcattattgaatgtacttgatgggttgttgctggctcttctaagcatgtgcacgcctgtcttgactccattcgtccacctgtgcaccttttgtagtccatttgttggaggcagtggttttcagttgaaaggcttgattttgaggtttgctcaatgcaaaatgtgggctctcttcttggccatgaaacctccttcaagtggaactatgtcttttaatcataaacttgtagtatgttgtcagaatgtgttaaatggcctctgtgcctgtaaaacctttatacaactttcagcaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcactccttggtattccgaggagtatgcctgtttgagtgtcagttaaatctcatttccctccggtttttgtttcaaggactggtttggggacttggatgtggaggttttgttggctttttgctaggtcagctcctctgaaatgtattagtggaactgtttgcaatccatcacaggtgtgataattcttgacgccattgggttgctctctgcttgttctgcttccaactgtctcactatatgtggacaaccattactgaacatttgacctcaaatcaggtaggattacccgctgaactt

×
×
  • Create New...