Jump to content
MycoMap Beta
Sequences
  1. S
    OM747645 Gerronema strombodes
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank

    cattactgaagaaatgataggagctgagctgactcttaggagtatgtgctcgcactatcgctttctccactctccactgtgcacctattgtaggctatgataactctcaaaaragggaagtcttttagggctttctgttttggatagaaggctatgcgattcgctttgcttgctttcaactttgtagcctatgttcatataaactctttgatagtctatgaatgtcatttgttggtcttttgaccgataaaaccctatacaactttcagcaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcaccttgcactccttggtattccgaggagtatgcctgtttgagtgtcattaaattctcaaaaacctagccgtttgtctttgaacggtctaggcttttggatgtgaggggtctatgctggctcgctgctgagtctggctccctttaaatgcattagtggttgcttcattcactagagtgtgatagcatatctacgctcgttacagtggactggataaatcatccgcttctaactgtcttgctttgccgagacaaaaaattcttttt

  2. S
    GI84-MO100133     ITS
    Mushroom Observer: Mushroom Observer #100133
    Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence

    CATTACTGAAGAAATGATAGGAGCTGAGCTGACTCTTAGGAGTATGTGCTCGCACTATCGCTTTCTCCACTCTCCACTGTGCACCTATTGTAGGCTATGATAACTCTCAAAARAGGGAAGTCTTTTAGGGCTTTCTGTTTTGGATAGAAGGCTATGCGATTCGCTTTGCTTGCTTTCAACTTTGTAGCCTATGTTCATATAAACTCTTTGATAGTCTATGAATGTCATTTGTTGGTCTTTTGACCGATAAAACCCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACTCCTTGGTATTCCGAGGAGTATGCCTGTTTGAGTGTCATTAAATTCTCAAAAACCTAGCCGTTTGTCTTTGAACGGTCTAGGCTTTTGGATGTGAGGGGTCTATGCTGGCTCGCTGCTGAGTCTGGCTCCCTTTAAATGCATTAGTGGTTGCTTCATTCACTAGAGTGTGATAGCATATCTACGCTCGTTACAGTGGACTGGATAAATCATCCGCTTCTAACTGTCTTGCTTTGCCGAGACAAAAAATTCTTTTT

Blast Searches
Run Blast Search
4RW43DXX015
×
×
  • Create New...