BLAST results are currently limited. Functionality will be restored in a few days.

Jump to content
MycoMap Beta
  • Sign in to follow this  

    DM3.108


    Stephen Russell
    • Forward Raw Sequence File: DM3.108-43636-E8-ITS1F.ab1 DM3.108-43636-E8-ITS1F.ab1 Reverse Raw Sequence File: DM3.108-43636-E8-ITS4.ab1 DM3.108-43636-E8-ITS4.ab1 Forward Primer: ITS1F, ITS1F Reverse Primer: ITS4, ITS4 MO Report Association: iNat Report Association: MycoPortal Association: GenBank Association: Primary Species: Lactarius flexuosus

      1AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAAAATGTGT
      61GAGGCATGCAATGGCTGTCGCTGACTTTTAACACAAAAGTCGTGCACGCCAGAGCGTGTC
      121CTCTCACATAAAATCCATCTCACCCTTTTGTGCACCACCGCGTGGGTGCCCTTCGGGATC
      181AAACCGATCCAGGAGGGGGCTTGCGTTTTCACACAAAACCCCTTTTTAAAAAGTGTAGAA
      241TGACCCCATTTTTTGCGATAACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGC
      301TCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGT
      361GAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTT
      421TGAGTGTCGTGAAAACCTCAACCTTCTCGGTTTCTTCTGGACACCGAAGGAGGCTTGGAC
      481TTTGGAGGCCTTTGCTGGCGTCTCGTCAGCTCCTCTCAAATGAATTAGCGGGGTCCTCTT
      541TGCCGATCCTCGACATGTGATAAGATGTTTCCATGTCTTTGGTTTCTGGCTCTGTTGCTT
      601TTGGGACCCGCTTCTAACCGTCTCAACCTTGCATCGAGACAAACGTTCGAGTGTGTCTCC
      661CTTCTCGGGGAACTCTCTCGAACCCACGAACCCTTGACCTCAAATCGGGTGAGACTACCC
      721GCTGAACTTA
      GenBank Submission Date: No value
    Sign in to follow this  



  • Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank
×
×
  • Create New...