Jump to content
MycoMap Beta
  • Sign in to follow this  

    Agaricus crocodilinus


    cappy
    • Forward Raw Sequence File: A4-_ITS1__E04.ab1 Reverse Raw Sequence File: A4-_ITS4__E04.ab1 Forward Primer: ITS1F Reverse Primer: ITS4 MO Report Association: iNat Report Association: MycoPortal Association: GenBank Association: Primary Species: Agaricus crocodilinus

      1TAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAGTATTCAAAAAGTAGTCTCACAA
      61AGTAGAGACAATTAGAAGCTGAACATTACTGAGAGCAATCCCCTCGCCAGTGTAGATAAT
      121TTATCACACTTGTGGCAGATCGCAAACGGTTCCGCTAATGCATTTCAGAGGAGCTGACCT
      181CAAACAAGTGGCCAGCAAGCCTCCACAGTCCAAGCTCTCTTTTACCAAACAGTATAAGAG
      241AGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGA
      301TGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCG
      361CTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATTACAATTT
      421TCATAGGCATACAAGCCCATGTAAAGACATTCAATGACATTCGACAGAGTATAATGAATG
      481ACATAGACTCCGGTGAGAAAGTGATTTCATGATCACATAAAGGACAGCAAAGTTTTCACA
      541ATGCAAGTCCTCACATCCAGCAAATGCTGATAGGATGACCACTTCCTCCTAACTCAACCA
      601AAGACTACAATAGGTGCACAGGTGGATGAAAATGAAGTCCAAACAGGCGTGCACATACTC
      661TAAAGAGCCAGCTACAACCCATTTGGAAACATAATTCAATAATGATCCTTCCGCAGGTTC
      721ACCTACGGAAGGATCATTATTGAATTATGTTTCCAAATGGGTTGTAGCTGGCTCTTTAGA
      781GTATGTGCACGCC
      GenBank Submission Date: No value
    Sign in to follow this  



×
×
  • Create New...