Jump to content
MycoMap Beta

  • Stephen Russell
    • FASTQ File: ONT.Kudzma4-J4-JAB290-1.fastq Forward Primer: ITS1F Reverse Primer: ITS4 MO Report Association: iNat Report Association: MycoPortal Association: GenBank Association: Reads in Consensus: 413 Primary Species: Suillus salmonicolor

      1GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAAATTATAATCCG
      61GCGAGGGGAAGGCGATGAGAACTGTCGCTGGCCCGTCTTAAAAACGGGCATGTGCACGCT
      121CTCTTTCCGGACCGTCGCCGTATGGGCGTGGGGGGGCGACCCCCCGCGTCTTCATATACC
      181TCTTCGTGTAGAAAGTCTTTGAATGTTTTATCATCGTCGAGTCGCGACTTCCAGGAGACG
      241CGATTCTTCGAGACAAAAGTTATTACAACTTTCAGCAATGGATCTCTTGGCTCTCGCATC
      301GATGAAGAACGCAGCGAATCGCGATATGTAATGTGAATTGCAGATCTACAGTGAATCATC
      361GAATCTTTGAACGCACCTTGCGCTCCTCGGTGTTCCGAGGAGCATGCCTGTTCGAGCGTC
      421AGTAAATTCTCAACCCCTCTCGATTAGCTTCGAGGCGGGGCTTGGATGGGTGGGGGCTGC
      481CGGAGACCTGGAATTCTTAAAAAATTTTCAGGACTCGGGCTCCTCTGAAATGCATCGGCT
      541TGCGGTCGACTCTCGACTTTGCGCAACAAGGCTTTCGGCGTGATAATGATCGCCGTTCGC
      601CGAAGCGCATGAACGAAACCGGTCCCGCGCCTCTAATCCGTCGATGCCCTTTCCGGGCGT
      661CTTCCTTATAGACGTTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTT
      GenBank Submission Date: No value Run Name: LinasKudzmaDec22
    Sign in to follow this  



×
×
  • Create New...