This site may be down for a portion of the day Monday, March 19th 2023 for a system update.

Jump to content
MycoMap Beta

  • Stephen Russell
    • FASTQ File: ONT09.93-E12-PDS_P2.47-iNat87733853-1.fastq Forward Primer: ITS1F Reverse Primer: ITS4 iNat Report Association: 141383298 - Cortinarius obtusorum Reads in Consensus: 411 Primary Species: Cortinarius obtusorum

      1AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTG
      61ATGAGTTGCTGCTGGTTCTCTAGGGAGCATGTGCACACTTGTCATCTTTATATCTCCACC
      121TGTGAACCTTTTGTAGACCTGAATATCTCTCTGAATGCCTGCAAAAATTCAGGTTTGAGG
      181ATTGATTCTTTTCTTTCCTCGCATTTTCAGGTCTATGTTTTTCATATACCCCCATGTATG
      241TTTATAGAATGTAATAAACGGGCCTTTGTGCCTATAAACTTATACAACTTTCAGCAACGG
      301ATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGC
      361AGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAG
      421CATGCCTGTTTGAGTGTCATTAATATATCAATCCTCTTCAGCCTTTTTGTCTGTTGGGTG
      481TTGGATGTGGGGGTTATTCTTTTTTGCTGGACTCTCCTTTGAGGTCAGCTCCCCTAAAAT
      541ACATTAGCAAAACAATTTGTTTACTGCTCATTGGTGTGATAACTATCTACGCTATTGATG
      601GTAAAGCACAGTTTAGCTTCTAGCAGTCCATTGACTTGGACAATCTTTTATCAATGTGAC
      661CTCAAATCAGGTAGGATTACCCGCTGAACTTAAG
      GenBank Submission Date: No value Run Name: DeSanto - ONT013
      Original Sequence - Wrong Orientation:
      CTTAAGTTCAGCGGGTAATCCTACCTGATTTGAGGTCACATTGATAAAAGATTGTCCAAGTCAATGGACTGCTAGAAGCTAAACTGTGCTTTACCATCAATAGCGTAGATAGTTATCACACCAATGAGCAGTAAACAAATTGTTTTGCTAATGTATTTTAGGGGAGCTGACCTCAAAGGAGAGTCCAGCAAAAAAGAATAACCCCCACATCCAACACCCAACAGACAAAAAGGCTGAAGAGGATTGATATATTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATAAGTTTATAGGCACAAAGGCCCGTTTATTACATTCTATAAACATACATGGGGGTATATGAAAAACATAGACCTGAAAATGCGAGGAAAGAAAAGAATCAATCCTCAAACCTGAATTTTTGCAGGCATTCAGAGAGATATTCAGGTCTACAAAAGGTTCACAGGTGGAGATATAAAGATGACAAGTGTGCACATGCTCCCTAGAGAACCAGCAGCAACTCATCAGGTTTATTTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTT


×
×
  • Create New...