Jump to content
MycoMap Beta

  • Stephen Russell
    • FASTQ File: ONT03.50-B07-BB090-iNat132747184-2.fastq Forward Primer: ITS1F Reverse Primer: ITS4 MO Report Association: iNat Report Association: 132747184 - Lactarius imperceptus MycoPortal Association: GenBank Association: Reads in Consensus: 285 Primary Species: Lactarius imperceptus

      1AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAAAATGTG
      61AGAGGGGTGCATGCTTGGGCTGTTGCTGGCTCAAAGTAGCCGTGCACGCCTGGGTGTGTC
      121CCCTCGCACAACAATCCATCTCACCCTTTTGTGCATCACCGCGTGGGCTCCCTTCTCGGA
      181GGGGGCTCGCGTTTTCACACAAACCCCCCCTTTTAAAAGTGTAGAATGACCTCATGTATG
      241CGTTAACCCGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAA
      301GAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTT
      361TGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAA
      421CCTCAACCTCCTTGGTTTCTTCTGGAGACCAAAGCAGGCTTGGACTTTGGAGGCCTTTGC
      481TGGCACCTCTCTTTTTGAAGGCCAGCTCCTCTTAAACAAATTAGCAGGGTCCTCTTTGCT
      541GATCCTCGACGTGTGATAAGATGTTTCCATGTCTTGGTTTCTGGCTCTGTCACCTTTGGG
      601ACCTGCTTCTAACTGTCCGGACCTTGCGTCGAGACAACGTTCGAGCATGTGCCTCCCTTC
      661TTGGGAAGCTCCCTCGACCCCACGAACCCTTGACCTCAAATCGGGTGAGACTACCCGCTG
      719AACTTAAG
      GenBank Submission Date: No value Run Name: SixthRun1
      Original Sequence - Wrong Orientation:
      CTTAAGTTCAGCGGGTAGTCTCACCCGATTTGAGGTCAAGGGTTCGTGGGGTCGAGGGAGCTTCCCAAGAAGGGAGGCACATGCTCGAACGTTGTCTCGACGCAAGGTCCGGACAGTTAGAAGCAGGTCCCAAAGGTGACAGAGCCAGAAACCAAGACATGGAAACATCTTATCACACGTCGAGGATCAGCAAAGAGGACCCTGCTAATTTGTTTAAGAGGAGCTGGCCTTCAAAAAGAGAGGTGCCAGCAAAGGCCTCCAAAGTCCAAGCCTGCTTTGGTCTCCAGAAGAAACCAAGGAGGTTGAGGTTTTCACGACACTCAAACGGGTGTGCCCCTCGGAATACCAAGGGGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTATTGATTGCGGGTTAACGCATACATGAGGTCATTCTACACTTTTAAAAGGGGGGGTTTGTGTGAAAACGCGAGCCCCCTCCGAGAAGGGAGCCCACGCGGTGATGCACAAAAGGGTGAGATGGATTGTTGTGCGAGGGGACACACCCAGGCGTGCACGGCTACTTTGAGCCAGCAACAGCCCAAGCATGCACCCCTCTCACATTTTGTACGATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTT
    Sign in to follow this  



  • Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Wrong Orientation
×
×
  • Create New...