Jump to content
MycoMap Beta
  • Sign in to follow this  

    B06-BB140-iNat127037906-1-127038944


    Stephen Russell
    • FASTQ File: ONT04.42-B06-BB140-iNat127037906-1.fastq Forward Primer: ITS1F MO Report Association: iNat Report Association: 127038944 - Hypomontagnella submonticulosa MycoPortal Association: GenBank Association: Reads in Consensus: 153 Primary Species: Hypomontagnella submonticulosa

      1AAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACTGAGTTATCCAAA
      61AACTCCCAACCCTATGTGAACTTACCACTGTTGCCTCGGCGAGCTGCGCTACCCTGTAGC
      121TACTTTTGTAGCGACCTGGGAGCGCGTTATAGGCTCGCCAGAGGACCACTAAACTCTGTT
      181TTATTTTGTATCTCTGAATCTTACAACTGAAATCAGTTAAAACTTTCAACAACGGATCTC
      241TTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAAT
      301TCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGC
      361CTATTCGAGCGTCATTTCAACCCTTAAGCCTCAGTAGCTTAGCGTTGGGAATCTACAGGT
      421TACAGCGTAGTTCCTTAAAGGTAGTGGCGGAGTTAGAGCACACTCTAAGCGTAGTACTTG
      481TTTCTCGCTTCTGGTAGTGGCTTTGACGGCCGGCCGTGAAACCCCCTATATTTCTAATGG
      541TTGACCTCGGATTAGGTAGGAATACCCGCTGAACTTAAG
      GenBank Submission Date: No value Run Name: SixthRun2
      Original Sequence - Wrong Orientation:
      CTTAAGTTCAGCGGGTATTCCTACCTAATCCGAGGTCAACCATTAGAAATATAGGGGGTTTCACGGCCGGCCGTCAAAGCCACTACCAGAAGCGAGAAACAAGTACTACGCTTAGAGTGTGCTCTAACTCCGCCACTACCTTTAAGGAACTACGCTGTAACCTGTAGATTCCCAACGCTAAGCTACTGAGGCTTAAGGGTTGAAATGACGCTCGAATAGGCATGCCCACTAGAATACTAATGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTGATTTCAGTTGTAAGATTCAGAGATACAAAATAAAACAGAGTTTAGTGGTCCTCTGGCGAGCCTATAACGCGCTCCCAGGTCGCTACAAAAGTAGCTACAGGGTAGCGCAGCTCGCCGAGGCAACAGTGGTAAGTTCACATAGGGTTGGGAGTTTTTGGATAACTCAGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGACTT
    Sign in to follow this  



  • Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Wrong Orientation
×
×
  • Create New...