Jump to content
MycoMap Beta

  • Stephen Russell
    • Forward Primer: ITS1F Reverse Primer: ITS4 MO Report Association: iNat Report Association: 98508094 - Ductifera pululahuana MycoPortal Association: GenBank Association: Reads in Consensus: 477 Primary Species: Ductifera pululahuana

      1GTCGTAACAAGGTTTCCGTAGGCATTCAAGTCTATCGGGGCGCCAGTAATGGTTCTTCCG
      61TGGAGTACACTTGCCGAAGCCTTAGTGGCCCGAAAGGGTTGATCCAGCGACTCTAAACAA
      121GTAGGCGTCATTAAACGCTAGTCCCCGAGTTCTAGGGGGCGACACTATCAAATTGCGGGG
      181AAATCCTGTCAAGTCTTCACTACCGCGGCTCGTCGAAAGGCAGAGTGCAGCACCGGGTTA
      241ATGACCTTGGGGATGGTAAAAACGTGAAGAATAGGGGCAATCCGCAGCCAAGCGCTAAGT
      301CTTTCCGGAGATATGCGTGCAGTTCACAGGCCAAATGGTAGTGGGCGTCTCTCTGAGACG
      361CTTAAGATATGGTCGAGCCCCATTCGAAAGTCTGGGTAAAAGACTCGTAACAAGGTTTCC
      418GTAGGTG
      GenBank Submission Date: No value Run Name: SecondRunSummary

    Original chimeric sequence:

    GTCGTAACAAGGTTTCCGTAGGCATTCAAGTCTATCGGGGCGCCAGTAATGGTTCTTCCGTGGAGTACACTTGCCGAAGCCTTAGTGGCCCGAAAGGGTTGATCCAGCGACTCTAAACAAGTAGGCGTCATTAAACGCTAGTCCCCGAGTTCTAGGGGGCGACACTATCAAATTGCGGGGAAATCCTGTCAAGTCTTCACTACCGCGGCTCGTCGAAAGGCAGAGTGCAGCACCGGGTTAATGACCTTGGGGATGGTAAAAACGTGAAGAATAGGGGCAATCCGCAGCCAAGCGCTAAGTCTTTCCGGAGATATGCGTGCAGTTCACAGGCCAAATGGTAGTGGGCGTCTCTCTGAGACGCTTAAGATATGGTCGAGCCCCATTCGAAAGTCTGGGTAAAAGACTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTTGGAGCCTCGCGGCTTCGCCACTTTCCGGCTGTGCGCCCTTTGCGGGGCTTGCACGCCGGGAATCCTTCACACACCTGTGCACCGTTCGTTTGGTGGGACCTCCGGGTTCGCCATTCGCCTTTACACCGAACGTCTGTCTCGAATGTCTAAACTTTTAAATAAGTGCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCGTGGTATTCCGCGGGGCATGCCTGTTTGAGTGTCACGTGAAACCTCATCCGGTCGATGTCAAAGTCGCACTCGGGTGGATTTGGACCGTGCCGTTTGTTCGGCTCGTCCTGAAATGCATTAGCTGGGTCGCCGGACCGTGTTGGCCGTGGTGTGATAATCTATCTGCGCCTATAAGTGCCTTTGGTTCGTGCGGTGCGGCTCATAACCGTCCCTTAAACGAGACAACTCTCTTTTAACGCTTTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTT

    Associated Records

    MycoMap

    98508094 - Ductifera pululahuana by MycoMap
    iNaturalist Reports


    Report Sequence



  • Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Wrong Orientation
×
×
  • Create New...