Jump to content
MycoMap Beta
  • Sign in to follow this  

    OFF2021.595-iNat98624634_ONT01.75-OFF2021.659-iNat98728934-2


    Stephen Russell
    • FASTQ File: ONT01.10-OFF2021.595-iNat98624634_ONT01.75-OFF2021.659-iNat98728934-2.fastq Forward Primer: ITS1F Reverse Primer: ITS4 MO Report Association: iNat Report Association: MycoPortal Association: GenBank Association: Reads in Consensus: 20 Primary Species: Fungi

      1GAGGAGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATT
      61GAATAAGCTTGGTTGGGTTGTTGCTGGCTCTTCGGGGCATGTGCACGCCTAACACCAACT
      121TTTTACCACCTGTGCACCTTTTGTAGACCTGGATATCTCTCGGGGAAACTCGGTATGAGG
      181ACTGCTGTGCGTCAAAGCCGGCTTTCCTTACATTTCCGGTCTATGTCTTTATATACACCA
      241TTTGTATGTCTATGAATGTTATTATCGGACTTGACTGTCCAATAAACCTTATACAACTTT
      301CAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT
      361GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTAT
      421TCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTTTTCGACTTTTTCTAAG
      481TCGACTGGGCTTGGATGTGGGAGTTTGCGGGCTTCTCCGAAGTCGGCTCTCCTTAAATTT
      541ATTAGTAGGGACCTCTGTTGCCTTAGCTTTTGGTGTGATAATTATCTACGCCGTCATGTG
      601AAGCAGCTTTAAATTGGGGTTACTGCTCTCTAACCGTCTCTTTGAAAT
      GenBank Submission Date: No value Run Name: Summary_test
    Sign in to follow this  



×
×
  • Create New...