This site may be down for a portion of the day Monday, March 19th 2023 for a system update.

Jump to content
MycoMap Beta

  • Stephen Russell
    • FASTQ File: ONT05.38-F05-CM23-01624.170-iNat147072999-2.fastq Forward Primer: ITS1F Reverse Primer: ITS4 iNat Report Association: 147072999 - Hericium coralloides Reads in Consensus: 23 Primary Species: Hericium coralloides

      1AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATACGCTTGG
      61ACTAGGTTGCTGCTGGCTCTTCAGGGAGCATGTGCACGCCCCCTCCATTTTTAACCTCCT
      121GTGCACCTTGCGTAGATCTGATACCTCTCGAGGCAACTCGGTTTGGGGATTGCTGTAACC
      181CCCGCGCCTTTTTTGTATTCAGGTCTATGTTTTTACATACCCCACATGAATGTATTCGAA
      241TGTCGTCAATGGGCCTTTGTGCCTTTAAAAACAAATACAACTTTCAACAACGGATCTCTT
      301GGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTC
      361AGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCT
      421GTTTGAGTGTCATGAAATTCTCAACCTTTCTCGCTTTTTCTGGCTTGGTTAGGCTTGGAT
      481TTTGGAGGTTGCTGGCTCATTGTGAATCAGCTCCTCTCAAATGCATTAGCAAAGACCTTT
      541GCTGACTCATCATTGGTGTGATAATTATCTACACCATCGACACCAGCTCCTTTATGGGAG
      601AGATCTTGCTTCTAATAGTCCCTTTGACAATTTGACAACTTGACCTCAAATCAGGTAGGA
      661CTACCCGCTGAACTTAAG
      GenBank Submission Date: No value Run Name: CM23-ONT014
      Original Sequence - Wrong Orientation:
      CTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAGTTGTCAAATTGTCAAAGGGACTATTAGAAGCAAGATCTCTCCCATAAAGGAGCTGGTGTCGATGGTGTAGATAATTATCACACCAATGATGAGTCAGCAAAGGTCTTTGCTAATGCATTTGAGAGGAGCTGATTCACAATGAGCCAGCAACCTCCAAAATCCAAGCCTAACCAAGCCAGAAAAAGCGAGAAAGGTTGAGAATTTCATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTATTTGTTTTTAAAGGCACAAAGGCCCATTGACGACATTCGAATACATTCATGTGGGGTATGTAAAAACATAGACCTGAATACAAAAAAGGCGCGGGGGTTACAGCAATCCCCAAACCGAGTTGCCTCGAGAGGTATCAGATCTACGCAAGGTGCACAGGAGGTTAAAAATGGAGGGGGCGTGCACATGCTCCCTGAAGAGCCAGCAGCAACCTAGTCCAAGCGTATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTT


×
×
  • Create New...