Jump to content
MycoMap Beta
  • Sign in to follow this  

    Mushroom Observer #508790


    MycoMap
    • MO Report Association: 508790 - Lactarius iNat Report Association: MycoPortal Association: GenBank Association: Parent Sequence: Primary Species: Lactarius

      1AGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCGGTCTTAGGCTGTCC
      61GAGTTGTAATTTAGAGAAGCGTCTTCCGCGCCGGACCGTGCACAAGTCTCCTGGAATGGA
      121GCGTCATAGAGGGTGAGAATCCCGTCTTTGGTAYGGATGCCCGGTGCTTCTGTGATGCGC
      181TCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAACTCCATCTAAA
      241GCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCAC
      301TTTGGAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTC
      361GCGTCGACCGAGACTCAGCCTTGCCTCGGCTTGGTGTACTTCTCGGCCCGACGGGTCAGC
      421ATCAATTTTGCCCCTCGGATAATGGCAAGGGAAAGGTGGCACCTTTACGGGTGTGTTATA
      481GTCTCCTGTCGCATGCGAGGGGTGGGATTGAGGAACTCAGCGCGCACCTTGGTGTCGGGG
      541CTTCGGCCCACGTCACGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGA
      601AACACGGACCAAGGAGTCCAACACRCCCGCGAGTGTTCGGGTGGAAAACCCGTGCGCGTA
      661ATGAAAGTGAAAGTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCAGACCTTCT
      721GTGACGGATCTGCGGTAGAGCGTGTGTGTTGGGACCCGAAAGATGGTGAACTATGCCTGA
      781ATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCG
      841ATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTG
      901CCGAAGTTTCCCTCAGGATAGCAGAAACTCATGTCAGATTTATGTGGTAAAGCGAATGAT
      961TAGAGGCCTTGGGGATGAAACATCCTTAACCTATTCTCAAACTTTAAATATGTAAGAACG
      1021AGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAA
      1081GCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATGCACGCTCA
      1141TCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGG
      1201AATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATG
      1261GCGCTCAAGCGTGCTACCCATACCT
      GenBank Submission Date: No value
    Sign in to follow this  



  • Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
×
×
  • Create New...