Jump to content
MycoMap Beta
  • Sign in to follow this  

    Mushroom Observer #478709


    MycoMap
    • MO Report Association: 478709 - Pholiota aurivella iNat Report Association: MycoPortal Association: GenBank Association: Primary Species: Pholiota aurivella

      1TTATTGAATGAACTTGGTATGATTGTTGCTGGCCCATCTGGGCATGTGCACGTCTGCCAT
      61CTTTATCTCTCCACCTGTGCACATATTGTAGGTCTGGAATAAATTTCTGAGGCAACTCAG
      121TAGTGGGGAATGCTGCTGCGAAGTGGCTTTGCCTGTAATTTCAGATCTATGTTTTCATAT
      181ACACCATAAAAATGTAACAGAATGTATTAATGGGTSTTGTACCTATAAACTATATACAAC
      241TTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAAYGCAGCGAAATGCGATAAGT
      301AATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGG
      361TATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAATCTTATTAGCTTTTGTT
      421AATTAAGACTTGGATGTGGGGGGGAAAATTTTTTGAAGGCTTCTCGCGAGCCTTCTCCCC
      481TAAAATGCATTAGCTGGTCGCTCGYGCGAACTGTCTATTGGTGTGATAATTATCTACGCC
      541ATTGACTAACTGCCATAGTAGCACTGCTTCTAATCGTCTTCGGACAATATA
      GenBank Submission Date: No value
    Sign in to follow this  



  • Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
×
×
  • Create New...