Jump to content
MycoMap Beta
  • Sign in to follow this  

    MT551946 Leucocoprinus fragilissimus


    Stephen Russell


    • Accession: MT551946
      Version: MT551946.1
      Locus: MT551946
      Other Seq IDs: gnl|uoguelph|NAMPA042-19.ITS,gb|MT551946.1|,gi|1858620716

      Source: Leucocoprinus fragilissimus
      Organism: Leucocoprinus fragilissimus

      Taxonomy: Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Agaricales; Agaricaceae; Leucocoprinus

      Reference # 1 Position: 1..726
      Reference # 1 Authors: Lodge,D. , Richards,T. , Schwartz,J. , Sheehan,B. , Roy,B. , Russell,S.
      Reference # 1 Title: NAMPA Sanger Sequences for GenBank Publication Batch 1
      Reference # 1 Journal: Unpublished

      Reference # 2 Position: 1..726
      Reference # 2 Authors: Lodge,D. , Richards,T. , Schwartz,J. , Sheehan,B. , Roy,B. , Russell,S.
      Reference # 2 Title: Direct Submission
      Reference # 2 Journal: Submitted (01-JUN-2020) Plant Pathology, University of Georgia, 135 Pine Bark Ln, Athens, GA 30605, USA

      Feature - Source:

      Location: 1..726
      Organism: Leucocoprinus fragilissimus
      Mol_type: genomic DNA
      Specimen_voucher: iNat35098933
      Db_xref: taxon:56176
      Country: USA: Georgia
      Collection_date: 03-Oct-2018
      PCR_primers: fwd_seq: cttggtcatttagaggaagtaa, rev_seq: tcctccgcttattgatatgc
      Feature - misc_RNA: {"location":"<1..>726","note":"contains small subunit ribosomal RNA, internal transcribed spacer 1, 5.8S ribosomal RNA, and internal transcribed spacer 2"}
      1 AAGTCGTAAC     AAGGTTTCCG     TAGGTGAACC     TGCGGAAGGA     TCATTATTGA     ATAAACACTT    
      61 GATGGGTTGT     CGCTGGTCTT     TCGGGACATG     TGCACGCCTG     TCTTGACTTC     TATTCATCCA    
      121 CCTGTGAACC     TTTTGTAGTC     TTGAACTTTT     TAAGGGATTG     TCGAGGAAGC     GGCTGCTCGG    
      181 TCTCTACCAA     GATCGGACTT     GAGGATTGCT     TTAGAGCTTT     CTTCTGTTGA     AGTCGTGAAA    
      241 TCGTGCCTTT     GAGAAGTTTT     GAGGCTATGT     CTTATATCAT     AAACCATGTA     GTATGTTGCC    
      301 AGAATGTATT     CAATGGGCCT     TTGTGCCTAT     AAAACCTTAT     ACAACTTTCA     GCAACGGATC    
      361 TCTTGGCTCT     CGCATCGATG     AAGAACGCAG     CGAAATGCGA     TAAGTAATGT     GAATTGCAGA    
      421 ATTCAGTGAA     TCATCGAATC     TTTGAACGCA     CCTTGCGCTC     CTTGGAATTC     CGAGGAGCAT    
      481 GCCTGTTTGA     GTGTCAGTAA     ATTCTCAACT     CCTTCAGCTT     TTTGTAGTTG     AAGTGAGCTT    
      541 GGATATGGAG     GTTTTGCGGG     TTCAATCTAA     TTGGATCGGC     TCCTCTGAAA     TGCATTAGCG    
      601 GAACCGTTTG     CGATCCGTCA     CAGGTGTGAT     AATTATCTAC     GCCTAGTGGG     TTGCTCTCTG    
      661 TCTTGTTCAG     CTNCCAACCG     TCCCAGTCAT     GGGACAACAT     CATTACTGAA     CTTTTGACCT    
      717 CAAATC    
      Location Needed: No
      MycoMap Location: Georgia, United States, UNITED STATES
      Collection Date: 10/03/2018 MycoMap Species Name: Leucocoprinus fragilissimus Metadata Verified: No Reference Link: Secondary References: Type: No MycoPortal Link: MO Link: iNaturalist Link: Reports Link: Undescribed?: No Parent Sequence:
    Leucocoprinus fragilissimus voucher iNat35098933 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

    Report Genbank Accession
    Sign in to follow this  



  • Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank
  • Blast Searches for MT551946
×
×
  • Create New...