Jump to content
MycoMap Beta
  • Sign in to follow this  

    LC549679 Lepiota clypeolaria


    MycoMap


    • Accession: LC549679
      Version: LC549679.1
      Locus: LC549679
      Other Seq IDs: dbj|LC549679.1|,gi|1861039814

      Source: Lepiota clypeolaria
      Organism: Lepiota clypeolaria

      Taxonomy: Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Agaricales; Agaricaceae; Lepiota

      Reference # 1 Position: 1..636
      Reference # 1 Authors: Maruyama,K. , Murakami,N.
      Reference # 1 Title: Two Lepiota species of genus Lepiota section Lepiota from Japan
      Reference # 1 Journal: Unpublished

      Reference # 2 Position: 1..636
      Reference # 2 Authors: Maruyama,K. , Murakami,N.
      Reference # 2 Title: Direct Submission
      Reference # 2 Journal: Submitted (24-MAY-2020) Contact:Koukichi Maruyama Tokyo Metropolitan University, Makino Herbarium; 1-1 Minami-Osawa, Hachioji, Tokyo 193-0932, Japan

      Feature - Source:

      Location: 1..636
      Organism: Lepiota clypeolaria
      Mol_type: genomic DNA
      Specimen_voucher: personal:Koukichi Maruyama:OS180916-48
      Db_xref: taxon:56165
      Country: Japan: Tokyo, Okutama
      Lat_lon: 35.7164 N 139.0318 E
      Collection_date: 2018-09-16
      Collected_by: Koukichi Maruyama
      PCR_primers: fwd_name: ITS-F_KYO2, fwd_seq: tagaggaagtaaagtcgtaa, rev_name: ITS4, rev_seq: tcctccgcttattgatatgc
      Feature - misc_RNA: {"location":"<1..>636","note":"contains internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2"}
      1 CAAGGTTTCC     GTAGGTGACC     TGCGGAAGGA     TCATTATTGA     ATAACTATGG     TGGGTTGTCG    
      61 CTGGCTTCTT     GAAGCATGTG     CACACCTGCT     GTCTTTATCT     ATCCCACTGT     GCACCACTTG    
      121 TAGTCTTGGA     GGGAAAGAGY     AGTCAAGCTC     CCCTTTCAGG     TCTATGTCTT     ATCCACAGAC    
      181 GTTGTAGTAT     GTCATAGAAT     GTAATCAAAG     GGCCTTTGTG     CCTATAGAAA     TCTATACAAC    
      241 TTTCAGCAAC     GGATCTCTTG     GCTCTCGCAT     CGATGAAGAA     CGCAGCGAAA     TGCGATAAGT    
      301 AATGTGAATT     GCAGAATTCA     GTGAATCATC     GAATCTTTGA     ACGCACCTTG     CGCTTCTTGG    
      361 TATTCCGAGG     AGCATGCCTG     TTTGAGTGTC     ATTAAATTCT     CAATCCCTTC     CAGTTTTTCA    
      421 CAAGCTGGGT     TGTGGCTTGG     ATATTGGGGG     TTTCTGCAGG     CCTTCTTTGG     GTCAGCTCCC    
      481 CTAAAATACA     TTAGCAGAAC     TGTTTGCGGT     CTGTCACTGG     TGTGATAATT     ATCTGCACCA    
      541 CGGCTGCTTT     CTGTTGTTCA     GCTTCTAACT     GTCTTCTTGG     ACAACTATTG     GAACATTTGA    
      601 CCTTCAAATC     AAGGTAGGAC     TACCCGCTGA     ACTTAA    
      Location Needed: No
      MycoMap Location: 奥多摩町, 西多摩郡, Tokyo Prefecture, Japan, 奥多摩町, Tokyo Prefecture, JAPAN
      Collection Date: 03/11/2022 MycoMap Species Name: Lepiota clypeolaria Metadata Verified: No Reference Link: Secondary References: Type: No MycoPortal Link: MO Link: iNaturalist Link: Reports Link: Undescribed?: No Parent Sequence:
    Lepiota clypeolaria personal:Koukichi Maruyama:OS180916-48 genes for ITS1, 5.8S rRNA and ITS2, partial and complete sequence

    Report Genbank Accession
    Sign in to follow this  



  • Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank
×
×
  • Create New...