Jump to content
MycoMap Beta Test
  • Sign in to follow this  

    KX881592 Phialocephala dimorphospora


    Stephen Russell


    • Accession: KX881592
      Version: KX881592.1
      Locus: KX881592
      Other Seq IDs: gb|KX881592.1|,gi|1240496897

      Source: Phialocephala dimorphospora
      Organism: Phialocephala dimorphospora

      Taxonomy: Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; Helotiales; Helotiales incertae sedis; Phialocephala

      Reference # 1 Position: 1..519
      Reference # 1 Authors: Markakis,E.A. , Kavroulakis,N. , Ntougias,S. , Koubouris,G.C. , Sergentani,C.K. , Ligoxigakis,E.K.
      Reference # 1 Title: Characterization of fungi associated with wood rot and decay of tree species and grapevine
      Reference # 1 Journal: Unpublished

      Reference # 2 Position: 1..519
      Reference # 2 Authors: Markakis,E.A. , Kavroulakis,N. , Ntougias,S. , Koubouris,G.C. , Sergentani,C.K. , Ligoxigakis,E.K.
      Reference # 2 Title: Direct Submission
      Reference # 2 Journal: Submitted (20-SEP-2016) Laboratory of Wastewater Management and Treatment Technologies, Department of Environmental Engineering, Democritus University of Thrace, Vas. Sofias 12, Xanthi 67100, Greece

      Comment: ##Assembly-Data-START## ; Assembly Method :: CAP3 v. online version ; Sequencing Technology :: Sanger dideoxy sequencing ; ##Assembly-Data-END##

      Feature - Source:

      Location: 1..519
      Organism: Phialocephala dimorphospora
      Mol_type: genomic DNA
      Strain: AXL1SP1
      Host: pear tree
      Db_xref: taxon:80717
      Country: Greece
      PCR_primers: fwd_name: ITS1, fwd_seq: tccgtaggtgaacctgcgg, rev_name: ITS4, rev_seq: tcctccgcttattgatatgc
      Feature - misc_RNA: {"location":"<1..>519","note":"contains internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2, and large subunit ribosomal RNA"}
      1 AAGGATCATT     AATCAGTGGA     TCCGGCGGGA     AGTTCCCCGC     CGGGTAGACC     TCCACCCGTG    
      61 CCTATCTACT     CTTGTTGCTT     TGGCGGGCCG     TGGCCTCCAC     TACGGGCTCT     GCTCGTACGT    
      121 GCCCGCCAGA     GGACCAAACT     CTGAATTTTA     GTGATGTCTG     AGTACTATTT     AATAGTTAAA    
      181 ACTTTCAACA     ACGGATCTCT     TGGTTCTGGC     ATCGATGAAG     AACGCAGCGA     AATGCGATAA    
      241 GTAATGTGAA     TTGCAGAATT     CAGTGAATCA     TCGAATCTTT     GAACGCACAT     TGCGCCCTGT    
      301 GGTATTCCGC     AGGGCATGCC     TGTTCGAGCG     TCATTTAGAC     CACTCACGCC     TGGCGTGGTA    
      361 TTGGGGCACG     CGGTTCCGCG     GCCCTCAAAA     TCAGTGGCGG     CGCCGGTAGG     CCCTAAGCGT    
      421 AGTAAATCTC     CTCGCTATAG     GGTCCTCTCG     GTGGCTCGCC     AGAACCCCCA     ACTTCTCAAG    
      481 GTTGACCTCG     GATCAGGTAG     GGATACCCGC     TGAACTTAA    
      Location Needed: Yes
      Collection Date: 01/01/1970 MycoMap Species Name: Phialocephala dimorphospora Metadata Verified: No Reference Link: Secondary References: Type: No MycoPortal Link: MO Link: iNaturalist Link: Reports Link: Undescribed?: No
    Phialocephala dimorphospora strain AXL1SP1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

    Report Genbank Accession
    Sign in to follow this  



×