Jump to content
MycoMap Beta Test
  • Sign in to follow this  

    KM044063 Phlebia tremellosa

    Stephen Russell

    • Accession: KM044063
      Version: KM044063.1
      Locus: KM044063
      Other Seq IDs: gb|KM044063.1|,gi|664651870

      Source: Phlebia tremellosa
      Organism: Phlebia tremellosa

      Taxonomy: Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Polyporales; Meruliaceae; Phlebia

      Reference # 1 Position: 1..630
      Reference # 1 Authors: Bont,Z. , Rigling,D. , Wunder,J.
      Reference # 1 Title: Stability assessment of Swiss protection forests using new high-resolution imaging techniques
      Reference # 1 Journal: Unpublished

      Reference # 2 Position: 1..630
      Reference # 2 Authors: Bont,Z. , Rigling,D.
      Reference # 2 Title: Direct Submission
      Reference # 2 Journal: Submitted (19-JUN-2014) Biodiversity and Conservation Biology, WSL Birmensdorf, Zurcherstrasse 111, Birmensdorf, Zurich 8903, Schweiz

      Comment: ##Assembly-Data-START## Sequencing Technology Sanger dideoxy sequencing ##Assembly-Data-END##

      Feature - Source:

      Location: 1..630
      Organism: Phlebia tremellosa
      Mol_type: genomic DNA
      Isolate: 4_3_2_2a
      Host: Picea abies
      Db_xref: taxon:98777
      Country: Switzerland: Canton Grisons, Obersaxen
      Altitude: 1610 m
      PCR_primers: fwd_name: its-1, fwd_seq: tccgtaggtgaacctgcgg, rev_name: its-4, rev_seq: tcctccgcttattgatatgc
      Feature - misc_RNA: {"location":"<1..>630","note":"contains internal transcribed spacer 1, 5.8S ribosomal RNA, and internal transcribed spacer 2"}
      Location Needed: No
      MycoMap Location: Obersaxen, Obersaxen, Grisons, SWITZERLAND Collection Date: 01/01/1970 MycoMap Species Name: Phlebia tremellosa Metadata Verified: No Reference Link: Secondary References: Type: No MycoPortal Link: Undescribed?: No
    Phlebia tremellosa isolate 4_3_2_2a internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

    Report Genbank Accession
    Sign in to follow this  

    User Feedback

    There are no comments to display.
