Jump to content
MycoMap Beta Test
  • Sign in to follow this  

    KM044063 Phlebia tremellosa


    Stephen Russell


    • Accession: KM044063
      Version: KM044063.1
      Locus: KM044063
      Other Seq IDs: gb|KM044063.1|,gi|664651870

      Source: Phlebia tremellosa
      Organism: Phlebia tremellosa

      Taxonomy: Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Polyporales; Meruliaceae; Phlebia

      Reference # 1 Position: 1..630
      Reference # 1 Authors: Bont,Z. , Rigling,D. , Wunder,J.
      Reference # 1 Title: Stability assessment of Swiss protection forests using new high-resolution imaging techniques
      Reference # 1 Journal: Unpublished

      Reference # 2 Position: 1..630
      Reference # 2 Authors: Bont,Z. , Rigling,D.
      Reference # 2 Title: Direct Submission
      Reference # 2 Journal: Submitted (19-JUN-2014) Biodiversity and Conservation Biology, WSL Birmensdorf, Zurcherstrasse 111, Birmensdorf, Zurich 8903, Schweiz

      Comment: ##Assembly-Data-START## Sequencing Technology Sanger dideoxy sequencing ##Assembly-Data-END##

      Feature - Source:

      Location: 1..630
      Organism: Phlebia tremellosa
      Mol_type: genomic DNA
      Isolate: 4_3_2_2a
      Host: Picea abies
      Db_xref: taxon:98777
      Country: Switzerland: Canton Grisons, Obersaxen
      Altitude: 1610 m
      PCR_primers: fwd_name: its-1, fwd_seq: tccgtaggtgaacctgcgg, rev_name: its-4, rev_seq: tcctccgcttattgatatgc
      Feature - misc_RNA: {"location":"<1..>630","note":"contains internal transcribed spacer 1, 5.8S ribosomal RNA, and internal transcribed spacer 2"}
      1 TCGAGTTTTT     GAAACGGGTT     GTCGCTGGTC     CGTTCTTAAC     AGAGTCGGGA     CATGTGCACA    
      61 CCTGGCTTCA     TTCCACTCTT     CAACCCCTGT     GCACTTGTTG     TAGGTTTCAG     GTCGGACGCG    
      121 GGGCTTTCGA     CTTCATCGTC     GAGAGCCTCA     AGGAAAGCCT     GAGCCTATGT     TTTACCATAC    
      181 ACACGCTTCA     GTTATAGAAT     GTAAACATCG     CGTATAACGC     ATTTTAAATA     CAACTTTCAG    
      241 CAACGGATCT     CTTGGCTCTC     GCATCGATGA     AGAACGCAGC     GAAATGCGAT     AAGTAATGTG    
      301 AATTGCAGAA     TTCAGTGAAT     CATCGAATCT     TTGAACGCAC     CTTGCGCTCC     TTGGTATTCC    
      361 GAGGAGCATG     CCTGTTTGAG     TGTCATGGAA     TTCTCAACCT     TTGAAAGCTT     TTATCGGTTC    
      421 TCAAAGGCTT     GGACTTGGAG     GTCGTGTCGG     CTCTGCAAAG     AATATCGACT     CCTCTGAAAC    
      481 GTATCAGTGC     GAACCTTTAC     GGATCGTCTT     CGGTGTGATA     AACGTCTACG     CCGTGGTCGT    
      541 GAAGTATGAT     CGTGTCCGTG     CTTCTAACCG     TCTCCTTTGC     GAGACAAAAA     CTGTGTTACT    
      601 TACTATAAGT     AACATAGGCA     TTGACAATCT    
      Location Needed: No
      MycoMap Location: Obersaxen, Obersaxen, Grisons, SWITZERLAND Collection Date: 01/01/1970 MycoMap Species Name: Phlebia tremellosa Metadata Verified: No Reference Link: Secondary References: Type: No MycoPortal Link: MO Link: iNaturalist Link: Reports Link: Undescribed?: No
    Phlebia tremellosa isolate 4_3_2_2a internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

    Report Genbank Accession
    Sign in to follow this  


    User Feedback


    There are no comments to display.


×