Jump to content
MycoMap Beta
  • Sign in to follow this  

    JQ666741 uncultured fungus


    MycoMap


    • Accession: JQ666741
      Version: JQ666741.1
      Locus: JQ666741
      Other Seq IDs: gb|JQ666741.1|,gi|387583325

      Keywords: ENV
      Source: uncultured fungus
      Organism: uncultured fungus

      Taxonomy: Eukaryota; Fungi; environmental samples

      Reference # 1 Position: 1..678
      Reference # 1 Authors: Sui,X.
      Reference # 1 Title: Effects of forest age on soil fungal community in a northern temperate forest
      Reference # 1 Journal: Unpublished

      Reference # 2 Position: 1..678
      Reference # 2 Authors: Sui,X.
      Reference # 2 Title: Direct Submission
      Reference # 2 Journal: Submitted (13-FEB-2012) Boundary Layer Ecology, Institute of Appied Ecology. Chinese Academy of Science, Wenhua Road, Shenyang, Liaoning 110016, China

      Feature - Source:

      Location: 1..678
      Organism: uncultured fungus
      Mol_type: genomic DNA
      Isolation_source: forest soil
      Db_xref: taxon:175245
      Clone: BE8
      Environmental_sample:
      Country: China: Changbai mountain
      PCR_primers: fwd_name: its1f, fwd_seq: cttggtcatttagaggaagtaa, rev_name: its4, rev_seq: tcctccgcttattgatatgc
      Feature - misc_RNA: {"location":"<1..>678","note":"contains 18S ribosomal RNA, internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2, and 28S ribosomal RNA"}
      1 CTTGGTCATT     TAGAGGAAGT     AAAAGTCGTA     ACAAGGTTTC     CGTAGGTGAA     CCTGCGGAAG    
      61 GATCATTACT     TAATCCACGG     CCGAAAGGCC     CGCTCGAAGC     GTCGGTGCCC     AACCCGGGTG    
      121 CCGGCGTGGA     CGGTAGACCC     TTTGTGAAAA     CCCCCTGTTG     CTTCGGCAGC     TCCTCCCCGT    
      181 CCGCCGGGGG     GGGTCAGCCT     GCCGATGGCA     CCCAGGAAAC     TCTTTTGAAA     TCAGTATTAA    
      241 ACCGCCTGAC     CGCGCAGTCG     AATGACTATA     AAACTTTCAA     CAACGGATCT     CTTGGTTCCC    
      301 GCATCGATGA     AGAACGCAGC     GAAACGCGAT     AGTTAATGTG     AATTGCAGAA     TTCAGTGAAT    
      361 CATCGAGTCT     TTGAACGCAC     ATTGCGCCTT     CTGGGATTCC     GGTAGGCACG     TCTGTTCGAG    
      421 CGTCAGTAAA     ACCTCTCCGG     TTTGCAATTT     TGTAGACACG     GTTTTTGGCG     TGGGGAGTGG    
      481 CCGCCGCGCT     TCGGTGCGGG     CAGGTTCCCC     CGCTTAAACG     TGAAGCTAGC     GGTAGATAAT    
      541 AATTGTGTTG     ACTCGTAGAA     TATACCGTCA     CCAGCCTTTA     GAATCCGCCG     CCTAAACTTC    
      601 GGGCTTTCGG     CCCCTGACTC     TTGACCTCGG     ATCAGATGAG     GATACCCGCT     GAACTTAAGC    
      661 ATATCAATAA     GCGGAGGA    
      Location Needed: No
      MycoMap Location: 泰山 Mount Tai, 泰山, Tai'an Shi, Shandong, China, Taishan Qu, Shandong, CHINA
      Collection Date: 01/01/1970 MycoMap Species Name: Environmental Sample Metadata Verified: No Reference Link: Secondary References: Type: No MycoPortal Link: MO Link: iNaturalist Link: Reports Link: Undescribed?: No Parent Sequence:
    Uncultured soil fungus clone BE8 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

    Report Genbank Accession
    Sign in to follow this  



  • UNITE
    Unite ID: SH470860.07FU
    Sequence Type: RepS Singleton
  • Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank
  • Blast Searches for JQ666741
×
×
  • Create New...