Jump to content
MycoMap Beta Test
  • Sign in to follow this  

    JN889990 uncultured fungus


    Stephen Russell


    • Accession: JN889990
      Version: JN889990.1
      Locus: JN889990
      Other Seq IDs: gb|JN889990.1|,gi|383290351

      Keywords: ENV
      Source: uncultured fungus
      Organism: uncultured fungus

      Taxonomy: Eukaryota; Fungi; environmental samples

      Reference # 1 Position: 1..1133
      Reference # 1 Authors: McGuire,K.L. , Allison,S.D. , Fierer,N. , Treseder,K.
      Reference # 1 Title: Ectomycorrhizal-dominated boreal and tropical forests have distinct fungal communities, but analogous spatial patterns across soil horizons
      Reference # 1 Journal: Unpublished

      Reference # 2 Position: 1..1133
      Reference # 2 Authors: McGuire,K.L. , Allison,S.D. , Fierer,N. , Treseder,K.
      Reference # 2 Title: Direct Submission
      Reference # 2 Journal: Submitted (21-OCT-2011) Biology, Barnard College, Columbia University, 3009 Broadway, New York, NY 10027, USA

      Feature - Source:

      Location: 1..1133
      Organism: uncultured fungus
      Mol_type: genomic DNA
      Isolation_source: ectomycorrhizal monodominant lowland tropical rainforest; soil 0-20cm
      Db_xref: taxon:175245
      Clone: GUYsoilC09
      Environmental_sample:
      Country: Guyana
      Lat_lon: 5.07 N 59.97 W
      PCR_primers: fwd_name: its1f, fwd_seq: cttggtcatttagaggaagtaa, rev_name: tw13, rev_seq: ggtccgtgtttcaagacg
      Feature - misc_RNA: {"location":"<1..>1133","note":"contains 18S ribosomal RNA, internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2, and 28S ribosomal RNA"}
      1 TTGAACAAAG     GCTTTTGGCT     GGATGTTGTT     GTGCTGGCCC     TTTTGGTGCA     ATGTGCACAC    
      61 TTCCCCCTCC     AGTCATTTGT     TTCTTCTGTT     CCACCTGTGC     ACTGCCTGTA     GATGCAACTC    
      121 TGTGTCTATG     ATAAATGCCT     ACACACACAA     TTGTATCTGT     ATTAGTTGGC     ATTATTACAT    
      181 GTATAAAAAT     ACAACTTTCA     ACAATGGATC     TCTTGGCTCT     CGCATCGATG     AAGAACACAG    
      241 CGAAATGTGA     TAAGTAATGT     GAATTGCAGA     ATCCAGTGAA     TCATCGAATC     TTTGAACGCA    
      301 TCTTGCGCTC     CTTGGCATTC     TGAGGAGCAT     GCCTGTTTGA     GTGTCATTAA     ACTATCAAAA    
      361 CTCTTTTCAC     GAGTGTTTTG     GACTTTGGGA     GTACTTCTGC     TGCTCTGTCT     GAGCCAGCTC    
      421 TCCTCAAAAG     CAATTAGTTG     GAGAAGACCC     ATCAGTGTGA     TAAATCTTTT     ACACTGGCTT    
      481 TCTCCTCTTA     ATAACTACAT     TATTTGACCT     CAAATCAGGT     AGGATTACCC     GCTGAACTTA    
      541 AGCATATCAA     TAAGCGGAGG     AAAAGAAACT     AACAAGGATT     CCCCTAGTAA     CTGCGAGTGA    
      601 AGCGGGAAAA     GCTCAAATTT     AAAATCTGGC     AGTCTCCTTT     TTCTTTTTTG     GCTGTCCGAG    
      661 TTGTAATCTA     GAGAAGTGCT     TACCTGCGCT     GGACCATGTA     TAAGTCTCCT     GGAATGGAGC    
      721 GTCACAGAGG     GTGAGAATCC     CGTCTTTGAC     ATGGACTGCC     AGTGTGTTGT     GGTGCGCTCT    
      781 CAAAGAGTCG     AGTTGTTTGG     GAATGCAGCT     CTAAATGGGT     GGTAAACTCC     ATCTAAAGCT    
      841 AAATATTGGC     GAGAGACCGA     TAGCGAACAA     GTACCGTGAG     GGAAAGATGA     AAAGGACTTT    
      901 GGAAAGAGAG     TTAAACAGTA     TGTGAAATTG     TTGAAAGGGA     AACGCTTGAA     GTCAGTTATG    
      961 TTGGCTAGGG     ATCAGCCTAG     TTTTCTGGGT     GAATTTCCTA     GTTTGACAGG     CCAACATCAG    
      1021 TTCTGACTGC     TGGAAAAGAG     CAGAGGGAAT     GTGGCACCTT     TGGGTGTGTT     ATAGCCTTTT    
      1081 GTCATATGTG     GCAGTTGGGA     CTGAGGGATG     CAGCATGCCG     TGAGGCCTTG     GTT    
      Location Needed: No
      MycoMap Location: Guyana, GUYANA Collection Date: 01/01/1970 MycoMap Species Name: uncultured fungus Metadata Verified: No Reference Link: Secondary References: Type: No MycoPortal Link: MO Link: iNaturalist Link: Reports Link: Undescribed?: No
    Uncultured fungus clone GUYSOILC09 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

    Report Genbank Accession
    Sign in to follow this  



×