Jump to content
MycoMap Beta Test
  • Sign in to follow this  

    JN889971 uncultured fungus


    Stephen Russell


    • Accession: JN889971
      Version: JN889971.1
      Locus: JN889971
      Other Seq IDs: gb|JN889971.1|,gi|383290332

      Keywords: ENV
      Source: uncultured fungus
      Organism: uncultured fungus

      Taxonomy: Eukaryota; Fungi; environmental samples

      Reference # 1 Position: 1..1134
      Reference # 1 Authors: McGuire,K.L. , Allison,S.D. , Fierer,N. , Treseder,K.
      Reference # 1 Title: Ectomycorrhizal-dominated boreal and tropical forests have distinct fungal communities, but analogous spatial patterns across soil horizons
      Reference # 1 Journal: Unpublished

      Reference # 2 Position: 1..1134
      Reference # 2 Authors: McGuire,K.L. , Allison,S.D. , Fierer,N. , Treseder,K.
      Reference # 2 Title: Direct Submission
      Reference # 2 Journal: Submitted (21-OCT-2011) Biology, Barnard College, Columbia University, 3009 Broadway, New York, NY 10027, USA

      Feature - Source:

      Location: 1..1134
      Organism: uncultured fungus
      Mol_type: genomic DNA
      Isolation_source: ectomycorrhizal monodominant lowland tropical rainforest; soil 0-20cm
      Db_xref: taxon:175245
      Clone: GUYsoilB01
      Environmental_sample:
      Country: Guyana
      Lat_lon: 5.07 N 59.97 W
      PCR_primers: fwd_name: its1f, fwd_seq: cttggtcatttagaggaagtaa, rev_name: tw13, rev_seq: ggtccgtgtttcaagacg
      Feature - misc_RNA: {"location":"<1..>1134","note":"contains 18S ribosomal RNA, internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2, and 28S ribosomal RNA"}
      1 TTATTGAACA     AAGGCTTTTG     GCTGGATGTT     GTTGTGCTGG     CCCTTTGGTG     CAATGTGCAC    
      61 ACTTCCCCCT     CCAGTCATTT     GTTTCTTCTG     TTCCACCTGT     GCACTGCCTG     TAGATACAAC    
      121 TCTGTGTCTA     TGATAAATGC     CTACACACAC     AATTGTATTA     GTTGGCATTA     TTACATGTAT    
      181 AAAAAATACA     ACTTTCAACA     ATGGATCTCT     TGGCTCTCGC     ATCGATGAAG     AACACAGCGA    
      241 AATGTGATAA     GTAATGTGAA     TTGCAGAATC     CAGTGAATCA     TCGAATCTTT     GAACGCATCT    
      301 TGCGCTCCTT     GGCATTCTGA     GGAGCATGCC     TGTTTGAGTG     TCATTAAACT     ATCAAAACTC    
      361 TTTTCACGAG     TGTTTTGGAC     TTTGGGAGTA     CTTCTGCTGC     TCTGTCTGAG     CCAGCTCTCC    
      421 TCAAAAGCAA     TTAGTTGGAG     AAGACCCATC     AGTGTGATAA     ATCTTTTACA     CTGGCCTTCT    
      481 CCTCTTAATA     ACTACATTAT     TTGACCTCAA     ATCAGGTAGG     ATTACCCGCT     GAACTTAAGC    
      541 ATATCAATAA     GCGGAGGAAA     AGAAACTAAC     AAGGATTCCC     CTAGTAACTG     CGAGTGAAGC    
      601 GGGAAAAGCT     CAAATTTAAA     ATCTGGCAGT     CTCCTTTTTC     TTTTTTGGCT     GTCCGAGTTG    
      661 TAATCTAGAG     AAGTGCTTAC     CTGCGCTGGA     CCATGTATAA     GTCTCCTGGA     ATGGAGCGTC    
      721 ACAGAGGGTG     AGAATCCCGT     CTTTGACATG     GACTGCCAGT     GCGTTGTGGT     GCGCTCTCAA    
      781 AGAGTCGAGT     TGTTTGGGAA     TGCAGCTCTA     AATGGGTGGT     AAACTCCATC     TAAAGCTAAA    
      841 TATTGGCGAG     AGACCGATAG     CGAACAAGTA     CCGTGAGGGA     AAGATGAAAA     GGACTTTGGA    
      901 AAGAGAGTTA     AACAGTATGT     GAAATTGTTG     AAAGGGAAAC     GCTTGAAGTC     AGTTATGTTG    
      961 GCTAGGGATC     AGCCTAGTTT     TCTGGGTGAA     TTTCCTAGTT     TGACAGGCCA     ACATCAGTTC    
      1021 TGACTGCTGG     AAAAGAGCAG     AGGGAATGTG     GCACCTTTGG     GTGTGTTATA     GCCTTTTGTC    
      1081 ATATGTGGCA     GTTGGGACTG     AAGGGATGCA     GCATGCCGTG     AGGCTTGGTT     TCGA    
      Location Needed: No
      MycoMap Location: Guyana, GUYANA Collection Date: 01/01/1970 MycoMap Species Name: uncultured fungus Metadata Verified: No Reference Link: Secondary References: Type: No MycoPortal Link: MO Link: iNaturalist Link: Reports Link: Undescribed?: No
    Uncultured fungus clone GUYSOILB01 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

    Report Genbank Accession
    Sign in to follow this  



×