Jump to content
MycoMap Beta Test
  • Sign in to follow this  

    HE998708 Phialocephala sp. OTU_017


    Stephen Russell


    • Accession: HE998708
      Version: HE998708.1
      Locus: HE998708
      Other Seq IDs: emb|HE998708.1|,gi|425474022

      Source: Phialocephala sp. OTU_017
      Organism: Phialocephala sp. OTU_017

      Taxonomy: Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; Helotiales; Helotiales incertae sedis; Phialocephala; Phialocephala fortinii species complex

      Reference # 1 Position: 1..446
      Reference # 1 Authors: Unterseher,M. , Persoh,D. , Schnittler,M.
      Reference # 1 Title: Leaf-inhabiting endophytic fungi of European Beech (Fagus sylvatica) are frequent in leaf litter but rare in decaying wood of the same host
      Reference # 1 Journal: Unpublished

      Reference # 2 Position: 1..446
      Reference # 2 Authors: Unterseher,M.
      Reference # 2 Title: Direct Submission
      Reference # 2 Journal: Submitted (25-SEP-2012) Institute of Botany and Landscape Ecology, University of Greifswald, Department of General and Systematic, Botany Grimmer Strasse 88, Greifswald D-17487, GERMANY

      Feature - Source:

      Location: 1..446
      Organism: Phialocephala sp. OTU_017
      Mol_type: genomic DNA
      Isolate: OTU_017_2010wo_04
      Isolation_source: dead attached branches
      Host: Fagus sylvatica
      Db_xref: taxon:1239397
      Country: Germany:Mecklenburg-Western Pomerania, Greifswald, nature conservation area Elisenhain
      Lat_lon: 54.5 S 13.3 E
      Collection_date: Apr-2010
      PCR_primers: fwd_name: V9G, fwd_seq: ttacgtccctgccctttgta, rev_name: ITS4, rev_seq: tcctccgcttattgatatgc
      Feature - misc_RNA: {"location":"1..446","note":"sequence contains ITS1, 5.8S rRNA gene and ITS2"}
      1 TCCCGCCGGA     TAGACCACAC     CCGTGTTTAC     CTACTCTTGT     TGCTTTGGCG     GGCCGTGGCC    
      61 TCCACTACGG     GCGCTGCTCG     TACGTGCCCG     CCAGAGGACC     AAACTCTGAA     TTATAGTGAT    
      121 GTCTGAGTAC     TATCTAATAG     TTAAAACTTT     CAACAACGGA     TCTCTTGGTT     CTGGCATCGA    
      181 TGAAGAACGC     AGCGAAATGC     GATAAGTAAT     GTGAATTGCA     GAATTCAGTG     AATCATCGAA    
      241 TCTTTGAACG     CACATTGCGC     CCTGTGGTAT     TCCGCAGGGC     ATGCCTGTTC     GAGCGTCATT    
      301 TAGACCACTC     ACGCCTGGCG     TGGTATTGGG     GCACGCGGTT     CCGCGGCCCT     CAAAATCAGT    
      361 GGCGGCGCCG     GTAGGCCCTA     AGCGTAGTAA     ATCTCCTCGC     TATAGGGTCC     TCTCGGTGGC    
      421 TCGCCAGAAC     CCCCAACTTC     TCAAGG    
      Location Needed: No
      MycoMap Location: Trent, K 5, Mecklenburg-Vorpommern, GERMANY Collection Date: 04/01/2010 MycoMap Species Name: Phialocephala sp. OTU_017 Metadata Verified: No Reference Link: Secondary References: Type: No MycoPortal Link: MO Link: iNaturalist Link: Reports Link: Undescribed?: No
    Phialocephala sp. OTU_017 genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, isolate OTU_017_2010wo_04

    Report Genbank Accession
    Sign in to follow this  



×