Jump to content
MycoMap Beta
  • Sign in to follow this  

    HE998708 Phialocephala sp. OTU_017

    Stephen Russell

    • Accession: HE998708
      Version: HE998708.1
      Locus: HE998708
      Other Seq IDs: emb|HE998708.1|,gi|425474022

      Source: Phialocephala sp. OTU_017
      Organism: Phialocephala sp. OTU_017

      Taxonomy: Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; Helotiales; Helotiales incertae sedis; Phialocephala; Phialocephala fortinii species complex

      Reference # 1 Position: 1..446
      Reference # 1 Authors: Unterseher,M. , Persoh,D. , Schnittler,M.
      Reference # 1 Title: Leaf-inhabiting endophytic fungi of European Beech (Fagus sylvatica) are frequent in leaf litter but rare in decaying wood of the same host
      Reference # 1 Journal: Unpublished

      Reference # 2 Position: 1..446
      Reference # 2 Authors: Unterseher,M.
      Reference # 2 Title: Direct Submission
      Reference # 2 Journal: Submitted (25-SEP-2012) Institute of Botany and Landscape Ecology, University of Greifswald, Department of General and Systematic, Botany Grimmer Strasse 88, Greifswald D-17487, GERMANY

      Feature - Source:

      Location: 1..446
      Organism: Phialocephala sp. OTU_017
      Mol_type: genomic DNA
      Isolate: OTU_017_2010wo_04
      Isolation_source: dead attached branches
      Host: Fagus sylvatica
      Db_xref: taxon:1239397
      Country: Germany:Mecklenburg-Western Pomerania, Greifswald, nature conservation area Elisenhain
      Lat_lon: 54.5 S 13.3 E
      Collection_date: Apr-2010
      PCR_primers: fwd_name: V9G, fwd_seq: ttacgtccctgccctttgta, rev_name: ITS4, rev_seq: tcctccgcttattgatatgc
      Feature - misc_RNA: {"location":"1..446","note":"sequence contains ITS1, 5.8S rRNA gene and ITS2"}
      Location Needed: No
      MycoMap Location: Trent, K 5, Mecklenburg-Vorpommern, GERMANY Collection Date: 04/01/2010 MycoMap Species Name: Phialocephala sp. OTU_017 Metadata Verified: No Reference Link: Secondary References: Type: No MycoPortal Link: MO Link: iNaturalist Link: Reports Link: Undescribed?: No
    Phialocephala sp. OTU_017 genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, isolate OTU_017_2010wo_04

    Report Genbank Accession
    Sign in to follow this  
