Jump to content
MycoMap Beta
  • Sign in to follow this  

    FJ553822 uncultured Pezizomycotina


    MycoMap


    • Accession: FJ553822
      Version: FJ553822.1
      Locus: FJ553822
      Other Seq IDs: gb|FJ553822.1|,gi|219813608

      Keywords: ENV
      Source: uncultured Pezizomycotina
      Organism: uncultured Pezizomycotina

      Taxonomy: Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; environmental samples

      Reference # 1 Position: 1..985
      Reference # 1 Authors: Hartmann,M. , Lee,S. , Hallam,S.J. , Mohn,W.W.
      Reference # 1 Title: Bacterial, archaeal and eukaryal community structures throughout soil horizons of harvested and naturally disturbed forest stands
      Reference # 1 Journal: Environ. Microbiol. 11 (12), 3045-3062 (2009)
      Reference # 1 Pubmed: 19659501

      Reference # 2 Position: 1..985
      Reference # 2 Authors: Hartmann,M. , Lee,S. , Chapman,W.K. , Hallam,S.J. , Mohn,W.W.
      Reference # 2 Title: Direct Submission
      Reference # 2 Journal: Submitted (16-DEC-2008) Microbiology & Immunology, University of British Columbia, 2350 Health Sciences Mall, Life Sciences Centre, Vancouver, BC V6T1Z3, Canada

      Feature - Source:

      Location: 1..985
      Organism: uncultured Pezizomycotina
      Mol_type: genomic DNA
      Isolation_source: forest soil from the long-term soil productivity (LTSP) site Skulow Lake
      Db_xref: taxon:282509
      Clone: LTSP_EUKA_P4J20
      Environmental_sample:
      Country: Canada
      Collection_date: Aug-2007
      PCR_primers: fwd_seq: ataacaggtctgtgatgccc, rev_seq: tcctccgcttattgatatgc
      1 TTAGATGTTC     TGGGCCGCAC     GCGCGCTACA     CTGACGGGGC     CAACGAGTAT     AATCCTTGAC    
      61 CGAAAGGTCT     GGGTAATCTT     GTTAAACCCC     GTCGTGCTGG     GGATAGGGCA     TTGCAATTAT    
      121 TGCCCTTCAA     CGAGGAATTC     CTAGTAAGCG     CAAGTCATCA     GCTTGCGTTG     ATTACGTCCC    
      181 TGCCCTTTGT     ACACACCGCC     CGTCGCTACT     ACCGATTGAA     TGGCTCAGTG     AGGCCTTCGG    
      241 ATTGGCTCAG     GGAGAGGGGC     AACCCTCACC     CAGAGCCGAG     AAGTTGGTCA     AACTTGGTCA    
      301 TTTAGAGGAA     GTAAAAGTCG     TAACAAGGTT     TCCGTAGGTG     AACCTGCGGA     AGGATCATTA    
      361 AAAAACTGGC     CGCCCTCGCG     GGTGGCCTGA     TGGCAACCGG     CGACCGCCCT     CCGGCGGGGA    
      421 CCGTACGCCT     AAACCCTTTG     TGAAAAACCC     CGGTTGCTTC     GGCAGCTCGT     CCCGGCGCCC    
      481 CTCGGGGACC     GGACGGTCAG     CCTGCCGACG     GCACTCCAGG     AAACCCTTTG     CTGTAAGGAA    
      541 AGCTCTCGAA     AGAGCACCGT     CTGAGCGCGA     AGTCTAATGA     CTATAAAACT     TTCAACAACG    
      601 GATCTCTTGG     TTCCCGCATC     GATGAAGAAC     GCAGCGAAAC     GCGATAATTA     ATGTGAATTG    
      661 CAGAATTCAG     TGAATCATCG     AGTCTTTGAA     CGCACATTGC     GCCTTTTGGT     ATTCCGAGAG    
      721 GCACGCCTGT     TCGAGCGTCA     GTAAAACCCA     TCCGTCGCGA     ATTTTACCGT     TCGCCGCGGG    
      781 AATTGGCGGG     GGATCCGGGA     CCGCCGCGCT     TCGGTGCGGC     CGGTCCTTCC     CCCGCTTAAA    
      841 CGCGTAGAAA     GCTAGCGGGC     CACGCCGCGA     CCGCAAGGAC     TAGTAAACCA     CCTGTCATTC    
      901 GGAAGCCTAG     TGACCGCCCG     ATTCCGGCAT     CCAATGCCAC     ACTGACTTTG     ACCTCGAATC    
      961 AGACGAGGAT     ACCCGCTGAA     CTTAA    
      Location Needed: No
      MycoMap Location: Canada
      Collection Date: 08/01/2007 MycoMap Species Name: Environmental Sample Metadata Verified: No Reference Link: Secondary References: Type: No MycoPortal Link: MO Link: iNaturalist Link: Reports Link: Undescribed?: No Parent Sequence:
    Uncultured Pezizomycotina clone LTSP_EUKA_P4J20 18S ribosomal RNA, 18S-25/28S ribosomal RNA intergenic spacer, partial sequence

    Report Genbank Accession
    Sign in to follow this  



  • UNITE
    Unite ID: SH470720.07FU
    Sequence Type: RepS Singleton
  • Problem Flags
    This sequence is a contaminant
    This sequence is the wrong specimen
    Low quality sequence
    Analytical Flags
    This sequence is the first record of the species from the state
    This sequence is the first record of the genotype in GenBank
    Multiple genotypes are going under this name in GenBank
  • Blast Searches for FJ553822
×
×
  • Create New...